Bilgi

Taq polimeraz nasıl üretilir?

Taq polimeraz nasıl üretilir?



We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

gördüm tak polimeraz "doğal" veya "rekombinant" olarak pazarlanmaktadır. Rekombinant versiyonun özel olarak değiştirilmiş tarafından üretildiğini anlıyorum. Escherichia koli içlerinde polimeraz üretimi için gen bulunan suşlar, ama ben "doğal" varyantı merak ediyorum. bunu hayal ediyorum termos aquaticus bir ortamda kültürlenmesi oldukça zordur; peki arkelerin "yerli" polimeraz üretmek için geldikleri kaynaklardan çıkarılması gerektiği doğru mu?


rekombinant için tak polimeraz, endüstriyel ölçekli üretim üretir litre Tek bir çalışmada yüksek konsantrasyonlu enzim. Satıldığında o kadar küçük, seyreltik miktarlarda gelir ki, araştırma laboratuvarı talebini karşılamak için yılda sadece birkaç hazırlık gerekli olur.

bilmiyorum termos aquaticus protokol, ancak verimdeki başarıları göz önünde bulundurarak E. koli, ve iki enzim arasındaki minimum fiyat farkı, verimlerin orada benzer olduğunu hayal ediyorum. Bu bana kimsenin kaplıca yetiştirmediğini söylerdi. T. sucul.


Taq DNA polimerazın ekstraksiyonu için basit ve etkili bir yöntem

Termostabil DNA polimeraz (Taq Pol Ι) termos aquaticus genellikle Pluthero'nun yöntemi ile ekstrakte edilen PCR'de yaygın olarak kullanılmaktadır. Yöntem, enzimi çökeltmek için amonyum sülfat kullandı ve zamandan değil, emekten ve paradan tasarruf sağladı. Ayrıca, amonyum sülfat çökeltme adımında Taq Pol I'in %30-40 aktivitesinin kaybolduğunu ve ürünün az miktarda DNA içerdiğini bulduk.

Sonuçlar

Enzimin aşırı üretiminden sonra Taq Pol Ι'yi saflaştırmak için yeni, basitleştirilmiş ve düşük maliyetli bir yöntem sağladık. Escherichia kolienzimi çökeltmek için amonyum sülfat yerine etanol kullanan . Çökelti, diyaliz olmaksızın depolama tamponunda doğrudan çözülebilir. Ek olarak, DNA ve RNA kontaminasyonu, çöktürmeden önce DNase I ve RNase A ile çıkarıldı ve ekstraksiyon prosedürü optimize edildi. İyileştirmelerimiz, enzimin geri kazanım oranını ve spesifik aktivitesini artırır ve işçilikten, zamandan ve maliyetten tasarruf sağlar.

Sonuçlar

Yöntemimiz, Taq Pol Ι'yi saflaştırmak için etanol, DNase I ve RNase A kullanır ve işlemi basitleştirir ve enzim geri kazanım oranını ve kalitesini artırır.


Taq DNA Polimeraz (klonlanmış)

Taq DNA Polimeraz, termofilik bakteriden saflaştırılmış tek bir alt birim enzimdir. termos aquaticus, ifade edilen doğal enzim E. koli. PCR için dNTP varlığında bir DNA şablonuna tavlanmış bir primerden DNA'yı polimerize eder.

  • Yüksek derecede saflaştırılmış rekombinant enzim.
  • Partiden partiye mükemmel tekrarlanabilirlik.
  • Her lotun nükleaz kontaminasyonu içermediği test edilir.

Taq DNA Polimeraz (klonlanmış), doğal enzimin rekombinant (farklı kaynaklardan gelen DNA segmentleri) formudur ve E. koli. Bu, hücresel reaksiyonlar için bir enerji kaynağı olarak hizmet eder ve sinyal yollarında yer alır.

Taq DNA Polimeraz (klonlanmış) son derece saf bir rekombinant protein olduğundan, 75°C'lik bir optimum sıcaklıkta ve >95°C'de tekrarlanan inkübasyonlarda hayatta kalma yeteneği ile mükemmel partiden partiye yeniden üretilebilirlik sağlar.

Taq DNA Polimeraz, PCR'de kullanım için lisanslanmıştır ve kontamine nikaz, tek ve çift sarmallı eksonükleaz ve endonükleaz aktiviteleri için kapsamlı bir şekilde test edilmiştir.


Taq PLUS DNA Polimeraz (3 Atıf)

Taq Plus DNA Polimeraz, 20 kb'ye kadar uzun şablonların yüksek doğrulukla amplifikasyonuna izin veren, prova okumalı bir DNA Polimeraz olan Taq DNA Polimeraz ve Pfu'nun bir karışımıdır. İki enzim, tek başına Taq DNA Polimeraz ile karşılaştırıldığında daha yüksek verimle daha doğru ve daha uzun PCR ürünleri üretmek için PCR sırasında sinerjik olarak hareket eder. Taq Plus DNA Polimeraz ile 20 kb uzunluğa kadar amplifiye edilmiş PCR ürünleri, kör uçlar ve tek baz (A) 3 çıkıntı karışımı içerir. Bu PCR amplifikasyonunun hata oranı, döngü başına nükleotid başına 7.5x10 -5'tir.

DEPOLAMAK TAMPON

20mM Tris.HCl (pH8.0), 100mM KCl, 3mM MgCl2, 1mM DTT, %0.1 Nonidet® P-40, %0.1 Tween® 20, 0.2mg/ml BSA, %50 (h/v) gliserol.

10X PCR TAMPON

100mM Tris-HCl (pH8.8), 500mM potasyum klorür, %1 Triton® X-100, 16mM MgCl2.

BİRİM TANIMI

Bir birim (U), bir substrat olarak ringa sperm DNA'sı kullanılarak 70°C'de 30 dakika içinde asitte çözünmeyen malzemeye 10 nanomol deoksiribonükleotidin dahil edilmesini katalize etmek için gereken enzim miktarı olarak tanımlanır.


Nedir tak polimeraz

tak polimeraz, DNA'yı sentezlemek için PCR'de kullanılan, ticari olarak temin edilebilen, termostabil bir DNA polimerazdır. adı verilen öbakteriden elde edilir. termos aquaticus. Bakterinin doğal yaşam alanı, ortam sıcaklığı 70-75 °C olan kaplıcalardır. yapısı tak polimeraz gösterilir Şekil 1.

Şekil 1: Taq Polimeraz

tak polimeraz, DNA polimeraz 1'e homolog olan 94 kD, DNA'ya bağımlı bir DNA polimerazdır. E. koli. Buradan, tak polimeraz, 3′ -OH nükleotid ekleme alanı, dNTP/DNA bağlanma alanı ve 5′ ila 3′ eksonükleaz alanından oluşur. Ancak, gelen nükleotidlerin düzeltme okuması için 3′ ila 5′ eksonükleaz alanından yoksundur.


Sonuçlar

Özetlemek gerekirse, bir füzyon NeqSSB-takS DNA polimerazdan oluşan tak Stoffel DNA polimeraz ve NeqSSB benzeri protein Nanoarchaeum equitans çok daha yüksek bir uzama oranı sergiler, daha yüksek işlenebilirlik sunar ve PCR inhibitörlerine karşı daha yüksek toleransa sahiptir. tak Stoffel DNA polimeraz. Bu nedenle, birçok PCR uygulamasında bir PCR kullanmak daha iyi olabilir. NeqSSB-takyerine S DNA polimeraz tak DNA polimeraz.


Taq enzimi

Taq enzimi, üretiminde işlev gören bakteriyel bir enzimdir. deoksiribonükleik asit (DNA ). Enzimin, benzer şekilde işleyen diğer bakterilere göre daha yüksek sıcaklıklarda işlev görme yeteneği. enzimler onu değerli kılmıştır polimeraz zincirleme reaksiyonu .

Takma adı, enzimin kökenini belirtir. Enzim olarak bilinen bir bakteri tarafından üretilir. termos aquaticus. Bu bakteri Thomas Brock tarafından 1970'lerin ortalarında Yellowstone Ulusal Parkı'ndaki bir kaplıca olan Mantar havuzunun neredeyse kaynayan sularında keşfedildi.

Taq bir DNA polimerazdır. Enzim, tek bir DNA dizisine tamamlayıcı olan bir DNA dizisi üretir. Tüm bakteri DNA polimeraza sahiptir. Taq polimerazın biyoteknolojik işlemlerde bu kadar önemli hale gelmesinin nedeni, enzimin ısıya karşı direncidir. A moleküler Biyoloji Polimeraz zincir reaksiyonu olarak bilinen teknik, çift sarmalın iki ipliğini ayırmak için DNA'nın ısıya maruz kalmasına dayanır. Taq daha sonra iki yeni DNA dizisinin üretimi için tekli dizilerin her ikisini de şablon olarak kullanabilir. Bu işlevi gerçekleştirmek için polimeraz, DNA tek sarmalı üzerindeki belirli yapı bloğunu veya nükleotidi tanıyabilir ve ardından belirli hedefe tamamlayıcı olan bir nükleotidi konumlandırabilir. İki nükleotidin bağlanması meydana gelir. Polimeraz daha sonra bir sonraki nükleotide geçebilir ve işlem tekrarlanır. DNA karışımının soğumasına izin verildiğinde, eşleşen zincirler birbirine bağlanır ve iki çift sarmallı DNA sarmalını oluşturur. Bu işlem defalarca tekrarlanırsa, DNA'nın hedef bölgesinin çok sayıda kopyası üretilebilir. Taq'ın ısı direnci, enzimin DNA zincirlerini birbirinden ayrı tutan sıcaklık koşullarında çalışmasına izin verir. Diğer bakterilerden, örneğin bakteriden DNA polimeraz Escherichia koli, polimeraz zincir reaksiyonunda taq polimeraz kadar verimli bir şekilde çalışmaz. termos aquaticus.

Taq enziminin keşfinden ve polimeraz zincir reaksiyonunun gelişmesinden bu yana, enzimin moleküler biyoloji araştırmaları ve ticari uygulamaları için önemi biyoteknoloji yükseldi. Taq polimeraz, hastalıkların moleküler teşhisinde ve adli tıpta ("DNA parmak izi") yaygın olarak kullanılmaktadır. Bu ve diğer taq uygulamaları, yılda yüz milyonlarca dolar değerinde bir endüstri yarattı.

Ayrıca bakınız DNA (Deoksiribonükleik asit) DNA hibridizasyonu Ekstremofiller Moleküler biyoloji ve moleküler genetik PCR


DNA Polimeraz ile Polimeraz Zincir Reaksiyonu Sırasında Hata Oranı Karşılaştırması

Daha büyük ölçekli klonlama projeleri daha yaygın hale geldikçe, PCR amplifikasyonu için kullanılan yüksek doğruluklu DNA polimerazları arasında karşılaştırmalara artan bir ihtiyaç vardır. PCR uygulamaları için pazarlanan tüm polimerazlar, satıcılar tarafından aslına uygunluk özellikleri (yani hata oranı tespiti) açısından test edilir ve çok sayıda literatür raporu PCR enzim aslına uygunluğunu ele almıştır. Bununla birlikte, çalışmadan çalışmaya çok sayıda metodolojik ve analitik farklılıklar nedeniyle farklı enzimler arasında doğrudan karşılaştırma yapmak genellikle zordur. Yüksek doğruluk gerektiren klonlama uygulamaları için tipik olarak kullanılan 3 polimeraz dahil, PCR uygulamalarında yaygın olarak kullanılan 6 DNA polimeraz için hata oranlarını ölçtük. Burada rapor edilen hata oranı ölçüm değerleri, klonlanmış PCR ürünlerinin doğrudan dizilenmesiyle elde edilmiştir. Burada kullanılan strateji, PCR klonlama için şablon olarak 94 benzersiz DNA hedefi kullanıldığından, çok büyük bir DNA dizi alanı boyunca hata oranının sorgulanmasına izin verir. Çalışmaya dahil edilen altı enzim, tak polimeraz, AccuPrime-Taq High Fidelity, KOD Hot Start, klonlanmış Pfu polimeraz, Phusion Hot Start ve Pwo polimeraz ile en düşük hata oranlarını buluyoruz Pfu, Füzyon ve Pwo polimerazlar. Bu 3 enzim için hata oranları karşılaştırılabilir ve aşağıdakilerle gözlemlenen hata oranından > 10 kat daha düşüktür. tak polimeraz. Mutasyon spektrumları, geniş ölçüde benzer mutasyon türleri sergileyen 3 yüksek kaliteli enzim ile rapor edilir. Bu enzimler için geçiş mutasyonları baskındır ve geçiş türü için çok az önyargı gözlemlenir.

1. Giriş

Örneğin genomik, proteomik ve metabolomik gibi sistem biyolojisi tabanlı araştırmalardaki hızlı gelişmelerle birlikte, daha büyük ölçekli biyolojik keşif projeleri daha yaygın hale geliyor. Başka bir deyişle, birçok projenin kapsamı bir/birkaç hedefin incelenmesinden yüzlerce, binlerce veya daha fazlasının incelenmesine doğru değişmiştir. Sistem biyolojisindeki gelişmelerle dönüştürülmüş bir araştırma örneği, cDNA substratlarından eksprese edilmiş açık okuma çerçevelerinin (ORF'ler) klonlanmasıdır. ORF klonlama için geleneksel yol, genellikle, belirli bir yola ilgili bir veya birkaç genin tanımlanmasını sağlayan deneysel gözlemlerle başlamıştır. Hedef(ler)in klonlanması daha sonra tipik olarak yol ayrıntılarının daha da iyileştirilmesiyle ve sıklıkla yeni klonlama hedeflerinin tanımlanmasıyla sonuçlandı. Genomik dizilerin veritabanlarının yaratılması ve sürekli iyileştirilmesiyle, klonlama artık genellikle çok daha büyük bir ölçekte gerçekleşiyor. Mikrodizi teknolojisi ve DNA dizileme atılımları, biyolojik veri tabanlarında bulunan ORF'lerin sayısında büyük bir artışa yol açmıştır. Ayrıca, biyolojik gözlemler, artık büyük ölçüde biyoinformatik temelli tahminler ve analizler tarafından yönlendirilen hedef tanımlamadan önce gelmek zorunda değildir. Büyük ölçekli klonlama çabalarının örnekleri arasında protein yapılarını sistematik olarak belirlemek için yapısal genomik projeleri [1], hastalık ve terapötik mekanizmaları anlamak için patojen ORF klonlaması [2] ve temel ve uygulamalı biyomedikal bilimlerde daha fazla gelişme sağlayacak olan tüm insan ORFeomunun oluşturulması yer alır. [3].

PCR klonlama sırasında hedefleri büyütmek için kullanılan DNA polimerazları, tipik olarak aşağıdaki aralıkta hata frekansları olan yüksek kaliteli enzimlerdir.

mutasyonlar/bp amplifiye edildi [4]. Yeterince büyük bir hedef DNA dizisi havuzu verildiğinde, yüksek kaliteli enzimler bile mutasyonlu klonlar üreteceğinden, PCR tarafından oluşturulan hataların en aza indirilmesi daha büyük ölçekli klonlama projeleri için özellikle önemlidir. Bir DNA polimerazın aslına uygunluğunu test etmek için çeşitli yöntemler vardır. Bununla birlikte, PCR enzimleri için hata frekansları, hemen hemen her zaman, sınırlı bir DNA dizi uzayını örnekleyen bir (veya birkaç) tanımlanmış DNA hedefi kullanılarak test edilir. Nispeten düşük sadakat kullanan erken çalışmalar tak DNA polimeraz, klonlanmış PCR ürünlerinin dizilenmesine dayanıyordu (örn., [5, 6]). Polimerazın aslına uygunluğunun düşük olması nedeniyle klonların doğrudan dizilenmesi, o zamanlar pratik bir yaklaşımdı, yani dizilenen çoğu klon en az bir mutasyon içerecekti.

Daha yüksek sadakatli polimerazların tanıtılmasıyla birlikte, mutasyonların varlığı için çok sayıda PCR ürününü hızla sorgulamak için yeni tarama yöntemleri geliştirildi. Bu tahliller, Kunkel ve meslektaşları tarafından geliştirilen ve bir DNA polimerazı ile bir boşluk doldurma reaksiyonu kullanan bir ileri mutasyon aslına uygunluk tahliline dayanıyordu. lacZ şablon dizisi, ardından ligasyon ve dönüştürme E. koli. Fonksiyonel bir temele dayalı kolorimetrik tarama lacZ geni, daha sonra DNA değişikliğinin doğasını belirlemek için dizilen mutasyonların hızlı tanımlanmasına izin verdi [7]. PCR ürünlerini mutasyonlar için taramak için benzer bir yaklaşım kullanıldı. lacZ DNA polimerazlar tarafından basit boşluk doldurmanın aksine, PCR ile amplifiye edilen fragman. Bazen farklı bir raportör gen kullanan bu yöntem, çeşitli yüksek kaliteli PCR enzimlerini taramak ve mutasyonları en aza indirmek için PCR reaksiyon koşullarını optimize etmek için kullanılmıştır [4, 8]. Son olarak, mükemmel duplekslere göre uyumsuzlukları olan reaksiyon ürünlerinin farklı kimyasal özelliklerine (yani erime sıcaklığına) dayanan PCR mutasyonlarını test etmeye dayanan yöntemler geliştirilmiş ve çeşitli enzim sistemlerine uygulanmıştır [9, 10]. Rapor edilen aslına uygunluk değerleri araştırma grupları ve tahlil yöntemleri arasında farklılık gösterse de, aşağıdaki gibi nispeten düşük aslına sahip bir enzimin olduğuna dair genel bir fikir birliği vardır. tak aslına uygunluk değeri vardır

aralık ve daha yüksek aslına uygunluk enzimleri, aralıkta olan değerlere sahiptir (genellikle iki katına çıkan şablon başına bp başına mutasyonlar olarak rapor edilir).

Yukarıda açıklananlar gibi tarama yöntemlerinin kullanılmasıyla ilgili bir değiş tokuş, tahlil sırasında genellikle yalnızca bir DNA dizisinin sorgulanmasıdır. Ek olarak, tahlillerde yerleşik olan sınırlamalar, tespit edilebilecek olası mutasyonları daha da kısıtlar. Örneğin, taramaya dayalı test lacZ gen amplifikasyon ürünleri, mutasyona uğradığında sadece 349 baz renk değişikliği üretecek olan tek bir 1.9 kb hedef kullanır [11]. Benzer şekilde, diferansiyel dupleks erime profillerine dayanan mutasyonların tayini, yeterince kısa, tipik olarak 100-300 bp aralığında ve tekli uyumsuzlukların çözülmesine izin veren termal erime profillerine sahip benzersiz hedef dizilerle sınırlıdır [9, 10].

Polimeraz hatalarının büyük ölçüde DNA dizi içeriğine bağlı olduğu bilindiğinden ([12]'de gözden geçirilmiştir), ideal olarak enzim aslına uygunluğu ölçülürken büyük bir DNA dizisi seti kullanılmalıdır. Bu, özellikle yüzlerce veya binlerce hedef içeren ve dolayısıyla neredeyse sonsuz bir DNA dizi alanı içeren büyük ölçekli klonlama projeleri bağlamında önem kazanır. Bu amaçla, klonlanmış PCR ürünlerinin doğrudan dizilenmesi yoluyla enzim doğruluğunu ölçen bir çalışma tasarladık ve yürüttük. DNA dizilimi için düşen maliyetler, bu aslına uygunluk belirleme yöntemini, çok az hata yapan enzimler için bile pratik hale getirdi. Hedeflerimiz, doğrudan klon dizilemesinden elde edilen aslına uygunluk değerlerini taramaya dayalı yöntemlerden türetilenlerle karşılaştırmak ve ayrıca bu sonuçları yüksek verimli bir klonlama projesi için bir enzim seçme bağlamında değerlendirmektir.

2. Sonuçlar ve Tartışma

PCR klonlamada kullanılan çeşitli DNA polimerazları için hata oranlarını belirlemek ve mutasyonel spektrumları gözlemlemek için, 94 farklı plazmit şablonundan üretilen klonları doğrudan sıraladık. Her biri benzersiz bir hedef DNA dizisine sahip olan bu plazmitler, hazırladığımız daha büyük bir glikoziltransferaz klonu grubunun bir alt kümesidir. Arabidopsis thaliana cDNA (el yazması hazırlanıyor). 94 plazmit, 360 bp ila 3,1 kb (medyan 1,4 kb) arasında değişen boyuta ve %35 ila %52 (medyan %44) arasında değişen GC içeriğine sahip eklere sahiptir. Bu çalışmada kullanılan 6 DNA polimerazın bir özeti Tablo 1'de sunulmuştur. tak Bu enzimin aslına uygunluk özellikleri hakkında var olan geniş literatür nedeniyle çalışmamızda polimeraz. Dahil edilen diğer enzimlerin tümü tipik olarak "yüksek doğruluk" olarak sınıflandırılır ve bu nedenle büyük ölçekli klonlama projeleri için potansiyel adaylardır. Ve farklı çalışmalar arasındaki tahlil ve niceleme yöntemlerindeki farklılıklar nedeniyle aslına uygunluk değerlerinin karşılaştırılması zor olsa da, burada çalışılan enzimlerin genel bir sıralaması (en düşük aslına en yükseğe) gibi görünmektedir. tak < AccuPrime-tak < KOD

Pfu Pwo < Phusion.

Klonlama boru hattımız, yüksek verimli klonlama çalışmaları için yaygın olarak kullanılan bir yöntem olan Gateway klonlama sistemi kullanılarak bir plazmit vektörüne saflaştırılmış PCR ürünlerinin rekombinasyonel eklenmesini kullanır ([17]'de gözden geçirilmiştir). Giriş plazmit DNA şablonlarımız Gateway sistemi kullanılarak hazırlandığından, ilgili hedef genlerin tümü, dikkat rekombinasyon dizileri. Bu, tüm PCR reaksiyonları için ortak primerlerin kullanılmasına izin verdi ve böylece hedefe özel optimizasyon ihtiyacını ortadan kaldırdı. PCR için şablon olarak saflaştırılmış plazmit DNA kullanıldı ve tüm durumlarda satıcı tarafından önerilen tamponlar kullanıldı. PCR reaksiyonunda iki katına çıkma sayısını maksimize etmek için küçük miktarlarda plazmit şablonu (25 pg/rxn) kullandık ve toplam plazmit boyutuna göre ekin boyutu, içinde bulunan hedef parça miktarını belirlemek için dikkate alındı. şablon. PCR protokolü, ≤2 kb (94 hedefin 82'si) hedefler için 2 dakika/döngü uzatma süresi ve >2 kb hedefler (94 hedefin 12'si) için 4 dakika/döngü ile 30 döngü amplifikasyon kullandı. Şekil 1, her enzim için temsili bir PCR reaksiyonu seti için jel görüntülerini gösterir. Tüm durumlarda, beklenen boyutta göç eden tek bir ana ürün bandı gözlemlendi. Amplifikasyon verimliliği, dsDNA'ya özgü bir boya kullanılarak PCR ürününün nicelleştirilmesi ve bilinen bir miktarda girdi DNA şablonuna dayalı olarak kat amplifikasyonunun hesaplanmasıyla ölçüldü. Katlama büyütmesi, PCR sırasında meydana gelen şablon ikilemelerinin sayısını belirlemek için kullanılır. Tablo 2'de bildirildiği gibi, bir plaka içindeki tüm numuneler için amplifikasyon verimliliği değerleri oldukça tekdüzeydi. Reaksiyonlarda rutin olarak daha az şablon iki katına çıktığını gözlemlememiz dışında, farklı enzimler arasında benzer amplifikasyon verimlilikleri gözlemliyoruz. Pfu polimeraz. Tüm enzimler için termodöngü protokollerini sabit tuttuk ve bu nedenle bazı parametrelerin amplifikasyon için optimal olmaması mümkündür. Pfu.

) bir plakadaki 94 PCR reaksiyonunun her biri için ikiye katlama değerlerinin ortalamasıdır, burada ikilemeler formülden hesaplanır

= (PCR/ng DNA girdisinden sonra ng DNA). Hata oranı (F) olarak hesaplanır F =

dizilenen tüm klonlar için gözlemlenen mutasyonların sayısıdır ve (hedef boyutu ×

klonlanan her hedef için.


Altı farklı enzim kullanılarak 24 benzersiz DNA hedefinin PCR amplifikasyonu ürünlerinin temsili agaroz jel elektroforez görüntüleri. Her şerit, tüm PCR reaksiyonunun 1/25'ini içerir. Beklenen ürün boyutları 1,4 ile 1,7 kb arasında değişmektedir.

Amplifikasyonun ardından PCR ürünleri, PEG/MgCl ile çökeltme yoluyla saflaştırıldı.2[18] boyutuna göre DNA'yı seçici olarak parçalara ayırdığı bilinen, kısa ürünleri <300 bp boyutunda çıkarmak için. Bu çökeltme adımı, numune sayısı arttığında bir gereklilik olan 96 oyuklu plaka formatında gerçekleştirilebilir. Bu protokolü rutin kullanım için benimsedik ve vektöre doğru boyutlu DNA'nın eklenmesi için, tipik olarak boyut kesmelerine sahip olan kit tabanlı PCR saflaştırmaları kullanılarak saflaştırmaya kıyasla daha yüksek bir verimlilik gözlemledik.

100 bp (veriler gösterilmemiştir). 300 bp'den büyük hedef dışı PCR ürünlerinin mevcut olduğu durumda, istenen ürünü izole etmek için jel ekstraksiyonu kullanılır. Saflaştırılmış PCR ürünleri, vektör DNA ve BP Clonase II ile inkübe edildi ve yetkin hücrelere dönüştürüldü. Plaka başına üç koloni toplandı ve 96 oyuklu plakalarda büyütüldü ve kültürler, koloni PCR ile doğru boyutta ek için tarandı. Beklenen boyutta (dönüşüm başına taranan 3 koloniden) bir eke sahip ortalama klon sayısı olarak ifade edilen BP Clonase II için ekleme etkinliği değerleri tipik olarak %80-90'dı (veriler gösterilmemiştir). Her hedef için, (eğer elde edilmişse) doğru boyutta bir ek içeren her hedef için bir veya daha fazla klon kültürlendi ve DNA dizilimi için kullanıldı.

Metot doğrulama amacıyla kullandık tak DNA polimeraz, bir Aile A DNA polimeraz ve en eski PCR deneylerinde kullanılan enzim [6]. PCR teknolojisinde erken bir çalışma atı olarak, tak polimeraz, aslına uygunluk belirleme amaçları için kapsamlı bir şekilde incelenmiştir. tak DNA polimeraz, 3′→5′ eksonükleaz aktivitesinden yoksundur ve bu nedenle DNA sentezi sırasında meydana gelen yanlış birleştirilmiş nükleotidleri düzeltemez. tahlil etmek için çeşitli tahliller kullanılmıştır. tak aslına uygunluk ve kullanılan yönteme bağlı olarak hata oranı değerleri (kalıp çoğaltması başına baz çifti başına mutasyonlar olarak ifade edilir) tak polimeraz aralığı

(örneğin, [7, 20]). Ayrıca, mutasyonel spektrum tak polimeraz, enzimin gelen dCTP'yi bir şablon timin nükleotidi ile yanlış birleştirme eğilimi nedeniyle baskın olan A•T → G•C geçişleri ile karakterize edilmiştir [6, 9, 21].

ile iki bağımsız PCR deneyinden klonların doğrudan sekanslanmasıyla tak polimeraz, hedef DNA sekansının >100 kbp'sinden 99 benzersiz mutasyon gözlemledik. Bireysel mutasyonların tipi ve sayısı Tablo 3'te listelenmiştir. Her PCR reaksiyonunun amplifikasyon verimliliği göz önüne alındığında, hata oranı (ortalama 2 deney) tak polimeraz

şablon çoğaltma başına mutasyonlar/bp. Bu değer, bu enzim için yayınlanmış diğer değerlerle mükemmel bir uyum içindedir ve nispeten yüksek varyans, 2 kata kadar farklılık gösteren hesaplanmış hata değerlerinin, deneysel gürültüye göre muhtemelen önemli olmadığını göstermektedir. Mutasyonların çoğu (99'un 67'si) A•T → G•C geçişleridir; bu, gelen dCTP'nin şablon A ile yanlış eşleşmesinden veya gelen dGTP'nin şablon T ile yanlış eşleşmesinden kaynaklanabilir. G•C→A•T tipi geçişler G şablonuyla gelen TTP'nin yanlış eşleşmesinden veya şablon C ile gelen dATP'nin yanlış eşleşmesinden kaynaklanan , ikinci en yaygın mutasyondur (99'un 28'i). 1 A•T→T•A ve 2 A•T→C•G değişikliği ile 3 transversiyon mutasyonu vardı. Genel olarak, baz ikame mutasyonlarının spektrumu, daha önceki gözlemlerle iyi bir uyum içindedir. tak Literatürde bildirilen polimeraz [7]. Veri setimizde gözlemlenen yalnızca bir ekleme veya silme (indel) mutasyonu vardı, bir

şablon dizisi. tak polimerazın, tümü homopolimerik çalışmalarda meydana gelen toplam mutasyonların yaklaşık %25'i kadar önemli bir sıklıkta indel mutasyonları ürettiği rapor edilmiştir [7]. Hedef havuzumuz, en az 4 bp'lik 1481 homopolimer çalışması örneği içerdiğinden, önceki tahlil koşulları ile burada kullanılanlar arasındaki diğer farklılıkların, tutarsızlığı açıkladığından şüpheleniyoruz. Spesifik olarak, önceki deneyler, yükseltilmiş magnezyum (burada kullanılan 1.5 mM'ye karşı 10 mM) ve yükseltilmiş dNTP seviyeleri (burada kullanılan 1 mM'ye karşı 0.2 mM) ile gerçekleştirilmiştir. Hem yüksek magnezyum hem de dNTP düzeylerinin daha sonra çerçeve kayması (indel) mutasyonlarını, tercihen baz ikame mutasyonlarına göre yükselttiği gösterildi [21].

Bu deneyler için önemli bir kontrol, DNA dizilimi için şablon oluşturmak için kullanılan yöntemle gereklidir. Daha büyük ölçekli klonlama projeleri için, hücre kültürü kullanılarak DNA dizilimi, saflaştırma plazmid DNA'sına göre zaman ve kaynak tasarrufu sağladığı için avantajlıdır. Bununla birlikte, hücre kültürü kullanılarak dizileme, bir PCR veya başka bir amplifikasyon adımı gerektirir ve bu adım prensipte bir "ek mutasyon" kaynağı olabilir. Bunu doğrudan ele almak için, üretilen klonların bir alt kümesinden hazırlanan miniprep DNA'yı sıraladık. tak polimeraz. Dizileme şablonu için kaynak olarak hücre kültürü kullanılarak alt kümede tespit edilen on dört mutasyonun her biri, plazmit DNA şablonundan dizileme yapılırken de gözlemlendi (veriler gösterilmemiştir). Yöntemimizin <%7 (1/14) yanlış pozitif oranına sahip olduğu ve PCR ile indüklenen mutasyonları test etmek için kabul edilebilir olduğu sonucuna vardık. Ayrıca elde ettiğimiz sonuçlara göre tak polimeraz için, aslına uygunluk belirleme yöntemimizin diğer çalışmalarla mükemmel uyum içinde sonuçlar verdiği ve bu nedenle polimeraz doğruluğunun doğru bir ölçüsü olduğu sonucuna vardık.

Sonuçlarımız, çalışmaya dahil edilen enzimlerin 3'ünün, Pfu polimeraz, Phusion Hot Start ve Pwo polimeraz, diğerlerinden önemli ölçüde daha düşük hata oranlarına sahiptir. Bu, bu enzimler için çok yüksek doğrulukta PCR amplifikasyonu gösteren önceki bulgularla tutarlıdır. İlginç bir şekilde, bu üç enzim için hata sıklığı değerleri birbirine son derece benzer, yaklaşık 2-3 × mutasyon/bp/kalıp ikiye katlanıyor. Küçük hata frekans değeri farkları muhtemelen önemli değildir, çünkü bu yüksek doğruluklu polimerazlar tarafından az sayıda mutasyon üretilir, ayrıca sonuçlar için yukarıda tartışılan deneysel değişkenliğe ek olarak. tak. Klonlama ve dizileme maliyetleri ve sınırlı araştırma bütçeleri göz önüne alındığında, klonların DNA dizilimi yoluyla mutasyon tespiti, enzim aslına uygunluğu yüksek olduğunda, nispeten küçük bir mutasyon veri seti üretir. Bu, testimizin bir dezavantajıdır ve DNA dizileme maliyetlerinin tarama bakterilerini düşürmeye devam etmesine rağmen, çok sayıda klonu sorgulamak için hala çok daha ekonomik bir yöntemdir. tarafından üretilen tüm mutant klonlar için Pfu, Phusion Sıcak Başlatma ve Pwo polimerazlar, numune işlemeyi veya DNA dizilemesini bir hata kaynağı olarak dışlamak için numuneler yeniden sıralandı. Her durumda, orijinal mutasyon mevcuttu ve PCR reaksiyonunun mutasyonun en olası kaynağı olduğunu doğruladı. Büyük ölçekli bir klonlama projesinde kullanım açısından, bu enzimlerden herhangi biri, hata oranını en aza indirme kriterlerine göre değerlendirilerek kabul edilebilir olacaktır. Amplifikasyon verimliliği, mutasyon spektrumları, yüksek GC içerik şablonlarıyla performans ve maliyet gibi birkaçını saymak gerekirse, elbette diğer faktörlerin de dikkate alınması gerekir. Mutasyon spektrumlarına gelince, 3 yüksek sadakatli polimerazın tümü, önemli bir şablon yanlılığı olmaksızın baskın olarak (> %75) geçiş mutasyonları üretti. Phusion enzimi ile translasyon okuma çerçevesinin korunması gereken klonlama uygulamaları için problemli olan %15 (2/13) indel mutasyonları gözlemledik. Her iki indel mutasyonu da tekrar bölgelerinde meydana geldi; bunlardan biri, bir

şablon dizisi ve diğeri bir (TCT) silinmesidir.

şablon dizisi. Bu sonuç, Phusion polimerazın yaygın olarak kullanılan diğer PCR enzimlerine (satıcı web sitesi) göre yüksek işlenebilirliği ışığında beklenmedikti. Birden fazla çalışma, artan polimeraz işlenebilirliğinin indel mutasyonlarıyla sonuçlanan kayma mutasyonlarının sıklığını azalttığını bulduğundan [22, 23], Phusion'ın bu hata sınıfının en azını üretmesini bekliyorduk. Bununla birlikte, bu sonucun küçük bir örnek boyutuna dayandığı ve doğrulama için daha fazla sayıda mutasyonun analiz edilmesi gerektiğine dikkat edilmelidir.

Burada test edilen enzimlerin hiçbirinin aşağıdaki hata oranına sahip olmaması bizim için ilginçti.

2 × . Literatürdeki diğer çalışmalar, PCR enzimleri için 10 −6'nın altında hata sıklıkları bildirmiştir,

[10] için Pfu diferansiyel dupleks T ile test edilen polimerazm ölçüm ve Phusion için 4,2 ×, BEAMING [16] adlı bir yöntemle test edilen HF tamponu kullanılarak. Phusion aslına uygunluk çalışması için, PCR burada kullanılandan farklı bir arabellek kullandı, bu da satıcıya göre 2-3 kat daha düşük hata oranıyla sonuçlanıyor. Ek olarak, bu çalışma, nükleotid varyasyonlarının varlığı için PCR ürünleri içeren çok sayıda boncukları tarayan son derece hassas bir akış sitometrik protokolü olan BEAMING yöntemini kullanır. Ancak, bu çalışmada sadece bir spesifik mutasyon, tek bir pozisyonda bir G•C → A•T mutasyonu sorgulandı. Bu nedenle, tahlil, tanımlanmış mutasyonların tespiti için son derece hassas olsa da, tek bir pozisyonda mutasyon frekansı için BEAMING yöntemiyle elde edilen sonuçlar, çok daha büyük dizi boşlukları için bir enzimin aslına uygunluk özelliklerini yansıtmayabilir. Çalışma için Pfu hata oranı, birkaç temel metodolojik farklılık mevcuttur: önceki çalışmada, PCR, önemli ölçüde daha kısa döngü süreleri ile "neredeyse anaerobik" koşullar altında gerçekleştirilmiştir, hedef boyut 93 bp ile sınırlandırılmıştır ve mutasyon tespiti fizyokimyasal bir yönteme dayanmaktadır: ayırma ve kapiler elektroforez ile uyumsuzluklar içeren PCR ürünlerinin izolasyonu [10]. Ve bu yöntem, normal ve kanser dokularından mitokondriyal DNA örneklerinde nadir görülen mutasyonların saptanmasında başarılı bir şekilde kullanılmış olsa da [24], bir mutasyonun değiştirilmiş bir erime profiline sahip bir molekülle sonuçlanması gerekliliği, mutasyonların sayısını saptırabilir. tespit olun. Sonuçlarımız ile bu önceki rapordan elde edilenler arasında büyük bir tutarsızlık Pfu Farklı mutasyon saptama metodolojilerine bağlanabilecek sadakat, Tablo 3'teki mutasyon spektrumu sonuçlarında görülebilir.

%90 (8/9) geçiş mutasyonları, G•C → A•T değişiklikleri için hafif bir önyargı. Buna karşılık, saptama için kapiler elektroforezi kullanan çalışma, tek bir A•T → G•C geçişi ve tek bir 1 bp delesyon mutasyonu ile baskın olarak (3/5) transversiyon mutasyonları ile sonuçlandı. Transversiyon mutasyonları, polimerazın ya bir pürin•purin ya da bir pirimidin•pirimidin uyumsuzluğu sentezlemesini gerektirir; bunların her ikisi de Aile B polimerazlarındaki farklı purin•pirimidin uyumsuzluklarına göre önemli ölçüde hoş karşılanmaz. Pfu polimeraz [25, 26]. Gözlemlediğimiz mutasyon türleri, diğer B Ailesi polimerazları için daha önce bildirilen mutasyonel spektrumlarla tutarlı olduğundan, yöntemimizin polimeraz hatalarını önyargısız bir şekilde tespit ettiğine inanıyoruz.

Çalışmamıza dahil edilen diğer iki enzim olan KOD polimeraz ve AccuPrime-tak Yüksek Sadakat, aşağıdakiler arasında aslına uygunluk değerlerine sahip tak polimeraz ve daha yüksek kaliteli enzimler. KOD polimeraz için gözlemlenen hata oranı sadece

4 kat daha düşük tak polimeraz ve

2.5 kat daha yüksek Pfu polimeraz. B Ailesi/pola benzeri bir polimeraz olan KOD polimerazın aslına uygunluğu hakkında ilk rapor Thermococcus kodakaraensis KOD1, çok az daha düşük bir hata oranı bildirdi Pfu polimeraz ve

4 kat daha düşük tak polimeraz [13]. Bu çalışmada bir ileri mutasyon tahlili (PCR değil) kullanılmış, aslına uygunluk PCR amplifikasyon verimliliği hesaba katılmadan beyaz kolonilerin maviye oranı olarak ifade edilmiş ve tipik PCR koşullarından önemli ölçüde farklı olan deneysel koşullar (Mg2+ konsantrasyonu) kullanılmıştır. Farklı bir raportör gen kullanarak, ancak yine de mutantların vahşi tip kolonilere basit bir oranını kullanarak, PCR koşulları altında aslına uygunluğu ölçen müteakip bir çalışma, hata oranları bildirdi

olanlara göre 50 kat daha düşük tak ve marjinal olarak daha düşük Pfu polimeraz [14]. Bu çalışmaların hiçbirinde mutant kolonilere yol açan moleküler değişikliklere dair bir rapor yoktu. Aynı araştırma grubundan olan bu iki sonuç arasındaki büyük fark, önemli metodolojik farklılıkların olduğu çalışmalar arasında karşılaştırma yapmanın zorluklarını vurgulamaya hizmet etmektedir. In the present study, we find that the mutation spectrum for KOD polymerase is similar to the other B-family polymerases (Pfu, Pwo, and Phusion) assayed here. As shown in Table 3, transitions predominate (14 of 16 mutations), with a slight bias (64%) for A•T → G•C mutations.

For the PCR performed with AccuPrime-tak High Fidelity system, we observed a 3-fold improvement in fidelity relative to tak polymerase. According to the vendor, AccuPrime-tak High Fidelity is an enzyme blend that contains tak polymerase, a processivity-enhancing protein, and a higher fidelity proofreading polymerase from pirokok Türler GB-D. The lower error rate seen with AccuPrime-tak most likely arises from the GB-D polymerase editing mistakes introduced by tak polymerase as opposed to enhanced processivity since increased processivity has been shown to have no significant effect on base substitution errors [22, 27]. The mutation spectrum of the blend is almost identical to that seen with tak polymerase alone, with transitions predominant and a significant bias for A•T → G•C changes (71% for AccuPrime-tak versus 73% for tak). However, it should be noted that a study on the mutation spectra of GB-D DNA polymerase (commercially available as Deep Vent) found A•T → G•C transitions to be the predominant mutation [28]. Detailed analysis on the contribution of each enzyme to the overall mutation spectrum is also precluded by the proprietary enzyme formulation used by the vendor.

In summary, we have used direct DNA sequencing of cloned PCR products to assay polymerase fidelity and evaluate other aspects of enzyme suitability for large-scale cloning projects. Based on minimizing PCR errors, Pfu polymerase, Pwo polymerase, and Phusion all produce acceptably low levels of mutations. Phusion was observed to produce more indel mutations than Pfu veya Pwo polymerases, although the total number of mutations was limited. This type of mutation is particularly problematic for ORF cloning projects and should be taken into account in the process of enzyme selection. Aside from fidelity considerations, amplification efficiency values were significantly higher for Phusion and Pwo nazaran Pfu, although further optimization of the PCR reaction for Pfu would likely improve efficiency values. Likewise, for cloning projects where targets are either very long or very highly GC-rich fidelity may be of lesser importance relative to the ability to amplify “difficult” target DNA. And finally, since the application space for PCR technology is huge, with cloning representing only a small fraction, enzymes other than those studied here need to be compared and evaluated based on project-specific needs and challenges.

3. Materials and Methods

3.1. PCR Reactions

All enzymes and reaction buffers were from commercial sources: Fermentas (tak polymerase), Invitrogen/Life Technologies (AccuPrime-tak), EMD Chemicals/Novagen (KOD Hot Start), Agilent (cloned Pfu polymerase), Finnzymes (Phusion Hot Start), and Roche (Pwo polymerase). PCR reactions were carried out in a final volume of 50 μL using buffer conditions and enzyme amounts recommended by the vendor. For reactions with Phusion, the GC buffer was used. In all cases, reactions included 0.2 mM each dNTP (Fermentas) and 0.2 mM each primer (IDT) with the sequences (5′ to 3′) GGGGACAAGTTTGTACAAAAAAGCAGGCTTCACC for the forward primer and GGGGACCACTTTGTACAAGAAAGCTGGGTC for the reverse primer. Template for PCR reactions was miniprep plasmid DNA, with each plasmid template containing a unique target sequence of known sequence and size, ranging from 0.3 to 3 kb. The target insert was cloned in between the att sites of a pDONR vector, allowing the use of a common primer set for all plasmids. Each PCR reaction contained 0.025 ng plasmid DNA, quantitated using the PicoGreen DNA quantitation reagent (Invitrogen/Life Technologies), and thus the amount of input target (ben) was calculated as

ng (size of target ÷ (size of target + size of plasmid)). The thermocycling protocol for all reactions with target length ≤2 kb was 5 minutes, 95°C, then 30 cycles of 15 seconds, 95°C → 30 seconds, 55°C → 2 minutes, 72°C, and finally 7 minutes at 72°C. For the targets >2 kb in size, the 2-minute extension step was extended to 4 minutes. For analysis of PCR products by gel, 2 μL of each PCR reaction was run on a 2% agarose eGel (Invitrogen/Life Technologies) run according to vendor recommendations.

3.2. Quantitation of PCR Reactions

Efficiency of PCR amplification was determined by measuring the amount of product using a modified PicoGreen dsDNA quantitation assay. This method was facilitated by optimizing the PCR reaction to produce a single product band (Figure 1). Using a Biomek FX-P (Beckman) automated liquid handing system, 5 μL of each PCR reaction was diluted 50-fold in TE buffer (pH 8) into a new 96-well plate. From this plate, 5 μL from each well was mixed with 195 μL of PicoGreen solution, a 500-fold dilution of dye in TE (pH 8). Fluorescence measurements were taken with a Paradigm (Beckman) plate reader. Background fluorescence was determined from a PCR reaction that contained no template DNA. Following background subtraction, DNA concentration was determined by comparing fluorescence readings to those obtained with a standard curve using DNA of known concentration supplied with the dye. Extent of target amplification (e) is calculated as e = (ng DNA after PCR) ÷ (ng of target DNA input), and the number of template doublings during PCR (NS) can be calculated as

3.3. Cloning of PCR Products

PCR reactions were purified in 96-well plate format by the addition of PEG 8000 and MgCl2 to final concentrations of 10% and 10 mM, respectively, directly to each well of the PCR plate using a multichannel pipettor. The plate was spun at 4000 rpm for 60 minutes at room temperature, and the supernatant was discarded. Pellets were washed two times with cold isopropanol, air-dried, and resuspended in 25 μL TE (pH 8). This protocol resulted in excellent yields (50–75%) of PCR products, with no products <300 bp, as judged by gel electrophoresis. Purified PCR products were cloned into a pDONR223 vector (a generous gift of Drs. Dominic Esposito and Jim Hartley, NCI, Frederick, MD) using BP Clonase II (Invitrogen/Life Technologies). Clonase reactions were assembled using a multichannel pipettor in 96-well PCR plates in a 5 μL volume and contained 75 ng pDONR223, 1 μL purified PCR product (typically 50–150 ng DNA), and 1 μL BP Clonase II. Sealed plates were incubated at least 16 hours at 25°C, and 1 μL of each reaction was immediately (no proteinase K treatment) used to transform either 25 μL or 50 μL of competent TOP10 cells (Invitrogen/Life Technologies). Following heat shock and recovery, following addition of 250 μL of SOC media, 100 μL of cells was plated on LB plates containing 50 mg/mL spectinomycin. Equivalent numbers of colonies were observed in transformations using 25 μL or 50 μL of frozen competent cells, and control BP reactions lacking BP Clonase II or PCR product resulted in no transformants.

3.4. Screening of Transformants

Three colonies from each transformation plate were picked and cultured in 96-well plates (Costar 3788) sealed with gas-permeable membrane, with each colony incubated in 150 mL of LB media with 50 mg/mL spectinomycin and 10% glycerol. After overnight incubation at 37°C (no shaking), 1 μL of each culture was used to screen by colony PCR for the presence of insert with expected size. Colony PCR reactions (25 mL) used the same primers used for cloning at a final concentration of 0.1 mM each, with 30 amplification cycles as described above, with GoTaq polymerase (Promega). Reactions were analyzed by agarose gel electrophoresis, and the presence of a band at or near the expected size was scored as a “hit.” The number of hits (0–3) for each target was determined, and an average number of hits per target for each plate were determined and used as a measure of Clonase reaction efficiency.

3.5. Clone Sequencing

In cases where Clonase efficiency values were >66%, average of at least 2 hits out of 3 colonies screened, the entire liquid culture plate was replicated with a 96-pin replicator onto an agar plate with the same dimensions as a 96-well plate. The plate was immediately submitted to an outside vendor (Quintarabio, Berkeley, CA), and after growth overnight sequencing was performed on amplified DNA from each clone. If Clonase efficiency values were <66% (tak ve Pfu polymerase reactions), a rearray step was added, using a Qpix2 colony picking robot (Genetix) to maximize the number of clones with correct-size insert on one plate. For comparing sequencing results using cells versus miniprep DNA, one plate of colonies picked from a tak cloning reaction was replicated into a 96-well deep well plate with 800 mL media per well and grown overnight with shaking at 300 rpm. Cells were pelleted, and DNA was prepared using a Qiaprep 96 Turbo Miniprep Kit (Qiagen). Eluted DNA was submitted directly for sequencing.

Çıkar Çatışması

Yazarlar, bu makalenin yayınlanmasıyla ilgili herhangi bir çıkar çatışması olmadığını beyan eder.

Teşekkür

This work was part of the DOE Joint BioEnergy Institute (http://www.jbei.org) supported by the U.S. Department of Energy, Office of Science, Office of Biological and Environmental Research, through Contract DE-AC02-05CH11231 between Lawrence Berkeley National Laboratory and the U.S. Department of Energy. The authors would like to thank Drs. Dominic Esposito and Jim Hartley (NCI, Frederick, MD) for the gift of pDONR223 DNA, Huu M. Tran (JBEI/Sandia National Laboratories) for assistance with the laboratory automation, Drs. Richard Shan and Sue Zhao (Quintara Biosciences, Berkeley, CA) for DNA sequencing and analysis, and Dr. Nathan J. Hillson for critical reading of the paper.

Referanslar

  1. B. G. Fox, C. Goulding, M. G. Malkowski, L. Stewart, and A. Deacon, “Structural genomics: from genes to structures with valuable materials and many questions in between,” Doğa Yöntemleri, cilt. 5, hayır. 2, pp. 129–132, 2008. View at: Publisher Site | Google Akademik
  2. A. Rolfs, W. R. Montor, S. Y. Sang et al., “Production and sequence validation of a complete full length ORF collection for the pathogenic bacterium Vibrio cholerae,” Amerika Birleşik Devletleri Ulusal Bilimler Akademisi Bildirileri, cilt. 105, no. 11, pp. 4364–4369, 2008. View at: Publisher Site | Google Akademik
  3. G. Temple, P. Lamesch, S. Milstein et al., “From genome to proteome: developing expression clone resources for the human genome,” Human Molecular Genetics, cilt. 15, hayır. 1, pp. R31–R43, 2006. View at: Publisher Site | Google Akademik
  4. J. Cline, J. C. Braman, and H. H. Hogrefe, “PCR fidelity of Pfu DNA polymerase and other thermostable DNA polymerases,” Nükleik Asitler Araştırması, cilt. 24, hayır. 18, pp. 3546–3551, 1996. View at: Publisher Site | Google Akademik
  5. A. M. Dunning, P. Talmud, and S. E. Humphries, “Errors in the polymerase chain reaction,” Nükleik Asitler Araştırması, cilt. 16, hayır. 21, p. 10393, 1988. View at: Publisher Site | Google Akademik
  6. R. K. Saiki, D. H. Gelfand, S. Stoffel et al., “Primer-directed enzymatic amplification of DNA with a thermostable DNA polymerase,” Bilim, cilt. 239, no. 4839, pp. 487–491, 1988. View at: Publisher Site | Google Akademik
  7. K. R. Tindall and T. A. Kunkel, “Fidelity of DNA synthesis by the Thermus aquaticus DNA polymerase,” biyokimya, cilt. 27, hayır. 16, pp. 6008–6013, 1988. View at: Publisher Site | Google Akademik
  8. J. M. Flaman, T. Frebourg, V. Moreau et al., “A rapid PCR fidelity assay,” Nükleik Asitler Araştırması, cilt. 22, hayır. 15, pp. 3259–3260, 1994. View at: Publisher Site | Google Akademik
  9. P. Keohavong and W. G. Thilly, “Fidelity of DNA polymerases in DNA amplification,” Amerika Birleşik Devletleri Ulusal Bilimler Akademisi Bildirileri, cilt. 86, hayır. 23, pp. 9253–9257, 1989. View at: Publisher Site | Google Akademik
  10. P. André, A. Kim, K. Khrapko, and W. G. Thilly, “Fidelity and mutational spectrum of Pfu DNA polymerase on a human mitochondrial DNA sequence,” Genom Araştırması, cilt. 7, hayır. 8, pp. 843–852, 1997. View at: Google Scholar
  11. G. S. Provost, P. L. Kretz, R. T. Hamner et al., “Transgenic systems for in vivo mutations analysis,” Mutation Research-Fundamental and Molecular Mechanisms of Mutagenesis, cilt. 288, no. 1, pp. 133–149, 1993. View at: Publisher Site | Google Akademik
  12. T. A. Kunkel and K. Bebenek, “DNA replication fidelity,” Annual Review of Biochemistry, cilt. 69, pp. 497–529, 2000. View at: Publisher Site | Google Akademik
  13. M. Takagi, M. Nishioka, H. Kakihara et al., “Characterization of DNA polymerase from Pyrococcus sp. strain KOD1 and its application to PCR,” Uygulamalı ve Çevresel Mikrobiyoloji, cilt. 63, no. 11, pp. 4504–4510, 1997. View at: Google Scholar
  14. M. Kitabayashi, Y. Nishiya, M. Esaka, M. Itakura, and T. Imanaka, “Gene cloning and polymerase chain reaction with proliferating cell nuclear antigen from Thermococcus kodakaraensis KOD1,” Bioscience, Biotechnology and Biochemistry, cilt. 66, hayır. 10, pp. 2194–2200, 2002. View at: Publisher Site | Google Akademik
  15. K. S. Lundberg, D. D. Shoemaker, M. W. W. Adams, J. M. Short, J. A. Sorge, and E. J. Mathur, “High-fidelity amplification using a thermostable DNA polymerase isolated from Pyrococcus furiosus,” Gen, cilt. 108, hayır. 1, pp. 1–6, 1991. View at: Publisher Site | Google Akademik
  16. M. Li, F. Diehl, D. Dressman, B. Vogelstein, and K. W. Kinzler, “BEAMing up for detection and quantification of rare sequence variants,” Doğa Yöntemleri, cilt. 3, hayır. 2, pp. 95–97, 2006. View at: Publisher Site | Google Akademik
  17. G. Marsischky and J. LaBaer, “Many paths to many clones: a comparative look at high-throughput cloning methods,” Genom Araştırması, cilt. 14, hayır. 10, pp. 2020–2028, 2004. View at: Publisher Site | Google Akademik
  18. J. T. Lis, “Fractionation of DNA fragments by polyethylene glycol induced precipitation,” Methods in Enzymology, cilt. 65, hayır. 1, pp. 347–353, 1980. View at: Publisher Site | Google Akademik
  19. J. J. Choi, J. Song, H. N. Ki et al., “Unique substrate spectrum and PCR application of Nanoarchaeum equitans family B DNA polymerase,” Uygulamalı ve Çevresel Mikrobiyoloji, cilt. 74, hayır. 21, pp. 6563–6569, 2008. View at: Publisher Site | Google Akademik
  20. L. L. Ling, P. Keohavong, C. Dias, and W. G. Thilly, “Optimization of the polymerase chain reaction with regard to fidelity: modified T7, Taq, and vent DNA polymerases,” PCR Methods and Applications, cilt. 1, hayır. 1, pp. 63–69, 1991. View at: Publisher Site | Google Akademik
  21. K. A. Eckert and T. A. Kunkel, “High fidelity DNA synthesis by the Thermus aquaticus DNA polymerase,” Nükleik Asitler Araştırması, cilt. 18, hayır. 13, pp. 3739–3744, 1990. View at: Publisher Site | Google Akademik
  22. J. F. Davidson, R. Fox, D. D. Harris, S. Lyons-Abbott, and L. A. Loeb, “Insertion of the T3 DNA polymerase thioredoxin binding domain enhances the processivity and fidelity of tak DNA polymerase,” Nükleik Asitler Araştırması, cilt. 31, hayır. 16, pp. 4702–4709, 2003. View at: Publisher Site | Google Akademik
  23. E. Viguera, D. Canceill, and S. D. Ehrlich, “Replication slippage involves DNA polymerase pausing and dissociation,” EMBO Dergisi, cilt. 20, hayır. 10, pp. 2587–2595, 2001. View at: Publisher Site | Google Akademik
  24. K. Khrapko, H. Coller, P. André et al., “Mutational spectrometry without phenotypic selection: human mitochondrial DNA,” Nükleik Asitler Araştırması, cilt. 25, hayır. 4, pp. 685–693, 1997. View at: Publisher Site | Google Akademik
  25. A. Niimi, S. Limsirichaikul, S. Yoshida et al., “Palm mutants in DNA polymerases α ve η Alter DNA replication fidelity and translesion activity,” Moleküler ve Hücresel Biyoloji, cilt. 24, hayır. 7, pp. 2734–2746, 2004. View at: Publisher Site | Google Akademik
  26. E. M. Kennedy, C. Hergott, S. Dewhurst, and B. Kim, “The mechanistic architecture of thermostable Pyrococcus furiosus family B DNA polymerase motif A and its interaction with the dNTP substrate,” biyokimya, cilt. 48, hayır. 47, pp. 11161–11168, 2009. View at: Publisher Site | Google Akademik
  27. T. A. Kunkel, S. S. Patel, and K. A. Johnson, “Error-prone replication of repeated DNA sequences by T7 DNA polymerase in the absence of its processivity subunit,” Amerika Birleşik Devletleri Ulusal Bilimler Akademisi Bildirileri, cilt. 91, no. 15, pp. 6830–6834, 1994. View at: Publisher Site | Google Akademik
  28. H. Huang and P. Keohavong, “Fidelity and predominant mutations produced by deep vent wild-type and exonuclease-deficient DNA polymerases during in vitro DNA amplification,” DNA and Cell Biology, cilt. 15, hayır. 7, pp. 589–594, 1996. View at: Publisher Site | Google Akademik

Telif hakkı

Copyright © 2014 Peter McInerney et al. Bu, Creative Commons Atıf Lisansı altında dağıtılan ve orijinal esere uygun şekilde atıfta bulunulması koşuluyla herhangi bir ortamda sınırsız kullanım, dağıtım ve çoğaltmaya izin veren açık erişimli bir makaledir.


How is Taq polymerase produced? - Biyoloji

Taq polimeraz is a thermostable DNA polimeraz named after the thermophilic bacterium Thermus aquaticus from which it was originally isolated by Thomas D. Brock in 1965 . It is often abbreviated to "tak Pol", and is frequently used in polimeraz chain reaction (PCR).
Yazının tamamı >>>

Nedir tak polimeraz? tak polimeraz is a DNA polimeraz (enzyme) isolated from the heat-tolerant bacterium Thermus aquaticus
Yazının tamamı >>>

tak DNA Polymerase is the most common polimeraz used for PCR reactions. . Applications: tak DNA Polymerase can be used in most applications including the .
Yazının tamamı >>>

<em>tak</em> DNA Polymerase is a thermostable DNA polimeraz that possesses a 5' . Ne zaman tak DNA Polymerase be used in a primer extension reaction or for PCR? .
Yazının tamamı >>>

<I>tak</I> DNA Polymerase is a thermostable DNA polimeraz that possesses a 5' . Ne zaman tak DNA Polymerase be used in a primer extension reaction or for PCR? .
Yazının tamamı >>>

High quality,Recombinant tak DNA Polymerase:EUR0.01/Unit!Order your free sample today!Bulk order,please contact us.Email:[email protected] .org.cn
Yazının tamamı >>>

Fastest to activate chemically modified hot start tak DNA polimeraz. . 5-6 - tak DNA Polymerase (temperature-dependent inhibitor), Vendor B .
Yazının tamamı >>>

tak DNA Polymerase has no detectable 3'=>5' exonuclease (proofreading) activity . The error rate of tak DNA Polymerase in PCR is 2.2x10-5 errors per nt per cycle, .
Yazının tamamı >>>

tak Polymerase. GENTAUR EUROPE +32 1658 9045 +32 1650 9045. BELGIUM. tel +32 2 732 5688 . Very robust tak DNA Polymerase. 500u. BIO-21040. 93 Euro. BIOTAQ .
Yazının tamamı >>>

tak polimeraz summary with 3 pages of encyclopedia entries, essays, summaries, research information, and more. . tak Polymerase : Forensic Science Terms. 35 .
Yazının tamamı >>>

tak polimeraz. Different concentrations of a tak polimeraz were tested using primer mixture C . Five native tak polymerases, from five different sources, .
Yazının tamamı >>>

Detection of viral RNA by polimeraz chain reaction (PCR) requires the prior . of this phenomenon has revealed direct interference of RT with tak polimeraz. .
Yazının tamamı >>>

. a broad range of pcr reagents,including taq polimeraz, PCR master mix, dNTPs, High-Stability PCR . Our best-sell tak DNA Polymerase offers your cost .
Yazının tamamı >>>

JNetDirect Biosciences - Biotechnology software, equipment and supplies distributor. . tak DNA Polymerase. TthPlus DNA Polymerase. Anti-tak Monoclonal .
Yazının tamamı >>>

Generally, standard tak DNA Polymerase has difficulty amplifying targets >5 kb. . general guidelines for primers to be used with Takara's Ex takPolymerase? .
Yazının tamamı >>>

Britannica online encyclopedia article on taq polimeraz (enzyme), . replenished after every cycle because it is not stable at the high temperatures needed for .
Yazının tamamı >>>

tak polimeraz. From Molecular Biology Wiki. Jump to:navigation, search. tak polimeraz is a thermostable DNA polimeraz named after the thermophilic .
Yazının tamamı >>>

PCR reagents from Bionexus include DNA amplification kits, DNA polymerases, and PCR Premixes to . Modified tak polimeraz activates at high .
Yazının tamamı >>>


Future Directions

Many properties affect the efficacy and utility of a PCR polymerase. Polymerase active site architecture and proofreading activity affect the accuracy of the final product. Polymerase blends and fusion to a DNA binding protein confer superior PCR performance for amplicon length and, in the case of the chimera, reaction speed. Other important advances in PCR, such as hot-start polymerases to increase reaction specificity, multiplex PCR (Figure 5) and qPCR have also revolutionized the life sciences.

As demonstrated by engineered blends and chimeras, properties of the polymerase itself can be modulated to improve PCR performance. In the future, it is likely that polymerase properties will increasingly be tailored to specific PCR applications, and as such, this is an important area of research at NEB.

Figure 5: The Multiplex PCR 5X Master Mix includes Taq DNA Polymerase and buffer that has been optimized for amplification of multiple targets. Its performance is illustrated in a 15-plex reaction with various amounts of human genomic DNA as template (shown below gel).


Videoyu izle: PCR - Polymerase Chain Reaction IQOG-CSIC (Ağustos 2022).