Bilgi

Kısa DNA iplikçiklerinin denatürasyonu için kavitasyon oluşturmayan ultrason (~20 bp)?

Kısa DNA iplikçiklerinin denatürasyonu için kavitasyon oluşturmayan ultrason (~20 bp)?


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

Çözeltide lokal olarak şiddetli şok dalgaları üreterek DNA'yı mekanik olarak denatüre eden ultrason kaynaklı geçici kavitasyon kabarcıkları hakkında mevcut araştırmaların olduğunu biliyorum.

Bunun mümkün olup olmadığını bilmek istiyorum kavitasyon yapmayan kısa DNA ipliklerini denatüre etmek için ultrason, ~20 baz çifti uzunluğunda (lütfen mümkünse kaynakları belirtin). Mekanizma, ultrasonun termal veya kavitasyon etkilerini içermeden mekanik olmalıdır. Ultrason, 10 MPa düzeyinde bir basınç dalgası gibi davranır ve DNA sarmalları, sıkıştırmayı açmayı başlatmak için ~15 pN'lik bir kuvvet gerektirir. Sadece bunun başarıyla kanıtlandığına dair kanıta ihtiyacım var.

Şimdiden teşekkür ederim.


Bölüm 4 - Preimplantasyon genetiğinde kullanılan moleküler biyoloji yaklaşımları: gerçek zamanlı PCR, mikrodiziler, yeni nesil dizileme, karyomapping ve diğerleri

Geçtiğimiz birkaç on yılda, yeni moleküler teknolojilerin gelişimi, başarılı bir hamilelikte rol oynayan iki ana faktörün değerlendirilmesiyle, üreme tıbbı alanında tanıda devrim yarattı: embriyo ve endometrium. Genetik olarak anormal embriyoların tespiti ve transkriptomikler kullanılarak optimum bir endometriyumun belirlenmesi, gebelik oranlarını artırmak için yardımcı üreme tedavilerinde bir öncelik haline gelmiştir. Bu bölüm, preimplantasyon genetik test karyotipleme, floresan in situ hibridizasyon, polimeraz zincir reaksiyonu, karşılaştırmalı genomik hibridizasyon dizisi, tek nükleotid polimorfizm dizisi, karyomapping ve yeni nesil gibi embriyo değerlendirmesi için yardımlı üremede halihazırda kullanılan moleküler tekniklere genel bir bakış sağlar. dizileme ve gen ekspresyonu yoluyla endometriyal değerlendirme için—gerçek zamanlı polimeraz zincir reaksiyonu, DNA mikrodizileri ve RNA-Seq. Her bölümde okuyucu, klinik pratikteki uygulama örnekleriyle birlikte her bir tekniğin moleküler ilkelerinin ayrıntılı bir tanımını bulacaktır.


Soyut

Polikistik over sendromu (PCOS), düzensiz adet sorunları, hiperandrojenizm ve polikistik overlerin varlığı ile karakterize çok faktörlü bir hastalıktır. Bugüne kadar, PCOS'un altında yatan moleküler mekanizma belirsizliğini koruyor. Son zamanlarda mitokondriyal yer değiştirme döngüsü (D-loop) varyantlarının PCOS patogenezinde yeni oyuncular olduğu tespit edilmiştir. Şu anda, yaygın varyantların yanı sıra nadir varyantlar da karmaşık hastalık riskine önemli katkı sağladığına inanıldığından araştırmaların odak noktasıdır. Bununla birlikte, mitokondriyal D-loop'taki nadir ve düşük hetroplazmik varyantlar, PKOS'lu kadınlarda hala araştırılmamıştır. Ayrıca, mitokondriyal DNA'nın (mtDNA) DNA replikasyonunun (OriL) hafif iplikli orijinindeki varyantlar PCOS'ta araştırılmamıştır. Bu nedenle, bu çalışmada, PKOS'lu kadınlarda mtDNA yeni nesil dizileme kullanılarak elde edilen nadir ila yaygın mitokondriyal D-loop ve OriL bölgesi varyantlarını araştırdık. Ayrıca, PCOS'lu kadınlarda mitokondriyal disfonksiyonun (MD) bir biyolojik belirteci olan mtDNA kopya sayısını da değerlendirdik, çünkü mtDNA'daki varyantların PCOS'lu kadınlarda düşük mtDNA kopya sayısı ile ilişkili olduğu biliniyor. 30 PCOS kadında 6 yeni varyant dahil olmak üzere toplam 67 D-loop varyantı tanımlandı. 67 varyant arasında, PCOS kadınlarında 29 varyant bildirilmiştir. İki PCOS kadında OriL bölgesinde tek bir varyant 5746A bulundu. Hem geçiş hem de geçiş varyantları bulundu, ancak geçiş varyantları, dönüşümlerle karşılaştırıldığında çok yüksek sıklıkta meydana geliyor (sırasıyla %82.35'e karşı %17.64). MtDNA'daki geçiş varyantlarının polimeraz γ hataları nedeniyle ortaya çıktığı bilindiğinden, yüksek geçiş oranlarının ortaya çıkması, çoğu mutasyonun, MD'ye yol açan mtDNA hasarına neden olan replikasyon hatalarındaki kusur nedeniyle ortaya çıktığını gösterir. Ayrıca, PCOS'lu kadınlarda mtDNA kopya sayısının sağlıklı kontrol kadınlarıyla karşılaştırıldığında düşük bulunması, MD'nin PKOS patogenezinde katkıda bulunan faktör olabileceğini düşündürmektedir.


Moleküler Teşhis Finali, moleküler final

kısıtlama endonükleazları hakkında?
bakteri genomunda yabancı DNA'nın istilasını ve replikasyonunu önlemek için bakteriler tarafından üretilen enzimlerdir.

Kanıta dayalı laboratuvar tıbbının aşağıdaki yönlerinden hangisi, belirli bir klinik laboratuvar testiyle ilgili olarak metodik bilgi araştırmasında şeffaf, tarafsız bir strateji sağlar?
sistematik inceleme.

Gerçek zamanlı pcr'de erken gözlemlenen ölçülebilir sinyaldeki artış neye bağlıdır?
hedef DNA'nın başlangıç ​​miktarı

VNTR'ler ve STR'ler ile, bir kişiye DNA'sını "parmak izi" vermek için değişen, belirli bir konumdaki ____'dır.
Tekrar sayısı

Hangi ifadeler HLA DNA tiplemesi ile serolojik halplotipler arasındaki ilişkiyi en iyi şekilde tanımlar?
Spesifik bir antijen veya antijen grubu ile reaktivite ile ilişkili her lokus için bir veya iki bant görülür.

Duchenne musküler distrofisinden etkilenen 20 yaşında bir erkek, bozukluğun asemptomatik heterozigot taşıyıcısı olan bir kadınla çiftleşir. bu çiftin kızlarının ne kadarı etkilenecek?
50%

Bir acil servisin sağlık personeli tarafından, bireyleri ilaç metabolize eden enzimlerdeki değişiklikleri test etmek için PCR ile mutasyon tespitini kullanan bir bakım noktası minyatür el tipi analizörü tasarlamanız istendi. Numune gereksinimleri yalnızca bir kılcal tüp (parmak çubuğu) kan miktarı (0,5 ml) olmalıdır. Böyle bir analizör tasarlayabilecek misiniz?
Evet, çünkü PCR tespiti için yeterli genomik DNA sağlamak için yeterli sayıda beyaz kan hücresi olacaktır.

Dolaşımdaki bir nükleik asit izolasyon prosedürünü gerçekleştirmeden önce kan hücresi nükleik asitlerinden kaynaklanan girişimi azaltmak için ilk adım olarak ne yapılabilir?
Kan örneği alırken antikoagülan olarak EDTA'yı seçin

Büyük bir moleküler sonda yapmak için bir insan genini bir bakteriye klonlamak hangi vektörü gerektirir?
plazmit

Jel elektroforezinde DNA migrasyon hızı öncelikle aşağıdakilere bağlıdır?
Genomik DNA'nın boyutu

Klinik laboratuvarda kullanım için mikrodizi teknolojisinin geliştirilmesi, arzunun doğrudan bir gelişimi miydi?
test için numune hacmi gereksinimlerini azaltın.

hibridizasyon deneylerinde kullanılan etiketli oligonükleotid probunun amacı nedir?
Spesifik nükleotid dizisinin varlığını tespit etmek için

Aşağıdaki alellerden hangisi genel popülasyonda en yüksek frekansa sahiptir?
metilen tetahidrofolat redüktaz mutasyonu

Elektroforez uygulanmış RNA'nın bir jelden özel bir naylon zar üzerine aktarılması işlemine ne ad verilir?
kuzey lekesi

mısır unu nakli için immünosupresan ilaç tedavisi alan bir kişide nörolojik hastalık semptomları vardı
HSV'ye Bağlı NÖROLOJİK HASTALIK

Tam kan örneklerinden genomik DNA'nın ekstraksiyonu ve değerlendirilmesi için en iyi olarak kabul edilen antikoagülan,
asit sitrat dekstroz ve potasyum EDTA

DNA jel elektroforezi ile ilgili aşağıdaki ifadelerden hangisi doğrudur?
Poliakrilamid jel, 2 kb'ye kadar yüksek çözünürlüklü daha küçük DNA molekülleri ile ayrılabilir

Hasta numunelerinin ve reaktiflerin amplikonlarla kontaminasyonunu önlemek için prosedürler ne zaman uygulanmalıdır?
yukarıdaki prosedürlerin tümü kontaminasyonu önlemek için kullanılır

Chlamydia Trachomatis için bir vajinal numunenin PCR analizi, kesim noktasının altında biyotinlenmiş reaksiyon ürününün optik yoğunluğunun negatif sonuç verdiğini gösterir. dahili kontrol sonucu da kesme değerinin altındadır. pozitif ve negatif kontroller kabul edilebilir sonuçlar verdi. ne önlem alınmalı?
sonuç rapor edilmemeli ve numune rapor edilmelidir

Bir nükleik asit
DNA veya RNA

Pyrosequencing dizi analizi ve nicelemeleri, dahil edilmiş bir dNTP'ninkine eşit bir miktarda ___ salınımına bağlıdır.
lusiferaz

Tek sarmallı konformasyonel polimorfizm SSCP analizi ile ilgili aşağıdaki ifadelerden hangisi yanlıştır?
SSCP'de bir PCR ürününün ayrılması, bir jel ile gerçekleştirilir THt, denaturantlara bir konsantrasyon gradyanı içerir.

Yukarıdaki soruda doğru olarak tanımlanan kalıtım modelini sergileyen bir bozukluğa örnek verir misiniz?
Prader-willi sendromu PWS

Bireyde hastalık belirtilerinin olmaması ve spesifik hastalığa neden olan gen mutasyonunun varlığına rağmen hastalığa yakalanma şansının azalmasına ne ad verilir?
azaltılmış penetrasyon

hibrit yakalama hangi temel tahlil tipidir?
hibridizasyon

Bir insülin reseptörü alt tipinin gen ifadesi için bir araştırma çalışması önerilmiştir. analiz için ne tür nükleik asit kullanılması gerektiğini belirlemeniz istendi. aşağıdaki örneklerden hangisi uygun olur?
mRNA

Günümüzde kullanılan çoğu otomatik nükleik asit izolasyon sistemi hangi izolasyon tekniği prensibini kullanır?
Katı Faz

Bir dizi kofaktörün bir DNA ipliğine bağlanmasını takiben, gerçek transkripsiyon işleminin gerçekleşmesi için gerekli olan enzim nedir?
RNA polimeraz II

Mitokondri DNA(mtDNA) ile ilgili aşağıdaki ifadelerden hangisi yanlıştır?
mtDNA'nın mutasyon oranı nükleer DNA'nınkinden 20 kat daha düşüktür.

Mitikondriyal DNA (mtDNA) ile ilgili aşağıdaki ifadelerden hangisi yanlıştır?
mtDNA'nın mutasyon oranı nükleer DNA'nınkinden 20 kat daha düşüktür.

Aşağıdaki sekanslarda aşağıdaki amino asit sekanslarına bakın, önce normal sekans verilir, ardından farklı sekans değişiklikleriyle üretilen sekanslar gelir. Her bir değiştirilmiş amino asit dizisine neden olan dizi değişikliklerinin türünü belirleyin.
normal: Phe Asn Pro Thr Arg
mutasyon 1: Phe Asn Pro
mutasyon 2: Phe Asn Ala Thr
mutasyon 3: Phe His Pro Thr Arg
3. mutasyona neden olan dizi değişikliğinin türü nedir?
yanlış anlama

Bir numunede inhibitörlerin varlığı nedeniyle bir nükleik asit testinin yanlış negatif sonuçlar verdiğinden endişe duyuyorsunuz. inhibitörlerin varlığını belirlemek için tahlilinize ne tür bir kontrol dahil edebilirsiniz.
Bir alikot örneğine hedef ekleme

Moleküler genetikle ilgili olarak, merkezi dogma şunu belirtir?
genler, nükleik asit dizileri olarak sürdürülür, ancak protein biçiminde ifade edilerek işlev görür.

RNA ekstraksiyon prosedürlerinde guanidinyum tuzları aşağıdakilere etki eder?
hücreleri lize eder ve RNaz'ı inhibe eder

Doğum öncesi tanı testleri için amniyotik sıvı örneğine kıyasla kronik villus örneklemesi CVS kullanmanın bir avantajı bu mu?
CVS örneği daha erken gebelikte alınabilir

HIV viral yük testleri ile ilgili olarak, yükteki değişikliği değerlendirirken sonuçların rapor edilmesi için tavsiye nedir?
log10 kopya olarak /ml

bir amplifikasyon reaksiyonu gerçekleştirirken olası amplikonun varlığını kontrol etmek için çalıştırılacak en iyi kontrol nedir?
Boş kontrol

Yukarıdaki soruyla devam eden bir doktor, viral yük testinden elde edilen sonuçların hastaların nihai sağlık sonucunu tahmin edip etmediğini sorun. Bunu belirlemek için bir çalışma olarak anılan?
prognostik değer çalışması

Bir desenin bir fotomaskeden silikon veya plastik bir gofret yüzeyine aktarılması olarak adlandırılır.
fotolitografi

Bir tümör baskılayıcı gen mi?
yukarıdaki cevapların hepsi doğru

Kolorektal kanserin değerlendirilmesinde, bir RNA polimeraz promotörü içeren bir primer ve bir translasyon sisteminde inkübe edilen sonuçtaki amplikonlarla bir translasyon başlatma sekansı ile her primer çifti ile ilgilenilen geni kapsayan çoklu PCR primer çiftleri ile tasarlanmış bir tarama testi olarak anılır?
protein kesme testi

Mikrodizi ve maroarray analizinde hangi moleküller etiketlenir?
örnek DNA

Belirli bir çocuğun biyolojik bir ebeveyninin tanımlanmasına yardımcı olmak için aşağıdaki test sistemlerinden hangisi kullanılabilir?
yukarıdaki cevapların hepsi doğru

bir kan numunesi santrifüjleme ile ayrıldığında sıvı bileşen hücrelerden ayrılır. serum mu?
İçinde pıhtılaşma faktörü olmayan sıvı bileşen

diğer ebeveynden normal alel almadan tek bir ebeveynden değiştirilmiş bir genin iki kopyasının kalıtımı nedir?
tek ebeveynli dizomi

45 yaşında bir erkek doktoruna konuşma bozukluğu, sakarlık, üst ekstremitelerinde istemsiz kıvranma hareketleri ile geliyor.
Huntington hastalığı

ticari nükleik asit ekstraksiyon kitlerinin kullanımıyla ekstrakte edilen minimum dolaşımdaki DNA veya RNA verimini önlemek için. için gerekli olabilir mi?
ekstraksiyon prosedüründe kullanılan numunenin hacmini artırmak

DNA, restriksiyon endonükleazları tarafından sindirildiğinde üretilen ürünleri hangi terim tanımlar?
kısıtlama parçası uzunluk polimorfizmleri

Akış sitometresi tarafından işlenen hücreleri geçitlemek için aşağıdaki parametrelerden hangisi kullanılır?
ileri ışık dağılımına karşı yan saçılım

Amniyotik sıvı örneğinin genomik DNA ekstraksiyonu için hazırlanması için doğru prosedür aşağıdakilerden hangisidir?
sıvı ile birkaç T25 doku kültürü şişesi kurun ve 9 ila 12 gün inkübe edin

bir hibridizasyon tekniği uygulayacaksınız ve probu hedef dizisine hibritleştirirken daha fazla baz çifti uyumsuzluğunu kabul etmeye istekli olacaksınız. aşağıdaki reaksiyon koşullarından hangisi kullanılacaktır.
yüksek tuz, düşük formamid, düşük sıcaklık

Erişkin beyin omurilik sıvısı BOS'unda herps simpleks virüsü HSV ensefalitinin değerlendirilmesi için mevcut altın standart yöntem nedir?
PCR

DNA dizisinin zincir sonlandırma reaksiyonunda. başka bir nükleotidi bağlamasını engelleyen dideoksinükleotidde (ddNTP) eksik olan nedir?
3' karbon üzerinde bir hidroksil grubu

Gerçek zamanlı PCR yöntemlerinde çoklu lokus ürünleri nasıl tanımlanabilir?
e primerlerini belirli florlarla etiketleyerek

Heparin, dolaşımdaki nükleik asitlerin izolasyonu için kullanılan kan örnekleri için ideal bir antikoagülan değildir, çünkü?
hücresel bütünlük iyi korunmaz.

PCR'deki ana karışım solüsyonu use9 reklamı aşağıdaki reaktiflerden hangisini içerir?
deoksiribonükleotit trifosfat

ABD'de ebeveynlik testi için kullanılan en yaygın yöntem hangisidir?
kısa tandem tekrar analizi

Belirli enterovirüslerin saptanması, viral RNA'yı saptamak için bir nükleik asit dizisine dayalı amplifikasyon NASBA testinin kullanılmasını içerir. Bu teknik, yüksek analitik özgüllük anlamı gösterir?
tahlilin enteroviral RNA'nın benzersiz bölgelerini çok az çapraz reaktivite ile tespit ettiğini.

Bir PCR amplifikasyon prosedüründe RNA kullanılacaksa, gerçekleştirilmesi gereken ilk adım nedir?
cDNA oluşturmak için bir ters transkripsiyon prosedürü gerçekleştirilmelidir

Aşağıdakilerden hangisi X bağlantılı çekinik soyağacının özelliklerindendir?
etkilenmemiş taşıyıcı dişiler aracılığıyla atlanan nesiller yaygındır.

DNA ile ilgili olarak bir ekson olarak tanımlanır?
olgun bir mRNA zincirinde temsil edilen ve proteine ​​çevrilen bir DNA parçası.

Hemoglobin S genini saptamak için en sık hangi DNA analizi yöntemi kullanılır?
PCR ve ardından RFLP

Bir BCR-ABL hibriti üreten kromozom 9 ve 22'nin füzyonu, KML'de meydana gelir ve KML olarak adlandırılan bir kromozom oluşturur.
Philadelphia kromozomu

Aşağıdakilerden hangisi klinik denetimin bileşenlerinden DEĞİLDİR?
Aynı sonucu üreten alternatif yaklaşımların maliyetinin değerlendirilmesi.

Bir ligaz bir enzimdir?
nükleik asitler arasındaki fosfodiester bağını yeniden düzenler

Kültürde hızla büyüyen bir organizma, nükleik asit tespiti ve teşhisi için daha uygun olan bir organizma mıdır?
YANLIŞ

Bir PCR reaksiyonu gerçekleştirilir ve negatif kontroller, saptanabilir sayıda PCR ürünü amplikonunun varlığını gösterir. en olası neden nedir?
numunenin eser miktarda şablon DNA ile kontaminasyonu

Bir t hücreli neoplaziyi tedavi etmek için kemoterapi görmüş bir hastada küçük bir <10^4 hücre klonal T lenfosit popülasyonunun varlığına ne ad verilir?
minimal kalıntı hastalık

Hangi ifade lösemide translokasyon testinin klinik faydasını doğru bir şekilde tanımlar?
Translokasyon, tedaviyi takiben hayatta kalan lösemi hücrelerini tanımlamanın hassas bir yoludur.

Fetal hücrelerde hemoglobin C geninin bulunup bulunmadığını belirlemek için hangi yöntem kullanılır?
PCR, ardından spesifik bir oligonükleotid probu ile lekeleme.

İmmünoglobulin veya t hücre reseptör gen yeniden düzenlemesinde hücre popülasyonunun klonalitesini belirlemek için kullanılan ve diğer analizlere göre daha az bozulmamış DNA gerektiren tahliller şunları içerir:
PCR

Analit konsantrasyonu neden minyatürleştirmenin klinik uygulamasında bir sınırlama olarak kabul edilir?
Hedef, bir mikrolitre numune üzerinde yüksek konsantrasyonda mevcutsa, bir mikrodizi tespit cihazında analiz için uygundur.

Aşağıdaki mutasyon türlerinden hangisi protein sentezinin erken sonlanmasına neden olur?
Saçmalık

Akış sitometrisinde kullanılan antikorlara en çok konjuge olan floresan boyalar nelerdir?
Fikoeritrin ve floresein izotiyosiyanat

Farmakogenetik değerlendirme için genotipleme tahlillerinin fenotipleme tahlillerine göre bir avantajı ne olabilir?
diyet, hormon, dalgalanmalar vb. gibi biyolojik çeşitlilik nedeniyle bireyler arası değişkenliğe tabi olmadıkları.

Farmakogenetik mi?
bir ilaca verilen reaksiyondaki genetik varyasyonun incelenmesi

Kalıtsal hemokromatoz hangi tür mutasyonun sonucudur?
tek nükleotid ikamesi

Genişletilmiş bir trinükleotid tekrarının neden olduğu genetik hastalıklar aşağıdakilerden hangisidir?
Kırılgan X sendromu

SNP bir IS?
tek nükleotid polimorfizmi

DNA ekstraksiyonu için bukkal hücreleri toplamak için bir swab kullanılıyorsa. swabın laboratuara taşınması için en iyi yol nedir?
tampon saline batırılmış

Aşağıdakilerden hangisi bakteri ve insan genomları arasındaki farklardan biri değildir?
çifte standart DNA'nın varlığı

Hangi ifade dallanmış DNA tek amplifikasyon yöntemini en iyi şekilde tanımlar?
hedef DNA çoklu problarla bağlanır ve bunlar hedef DNA yerine amplifiye edilir

hangi ifade floresan in situ hibridizasyon (balık) sürecini doğru bir şekilde tanımlar
hibridizasyon doğrudan bozulmamış kromozom üzerinde gerçekleştirilir

Laboratuvara yeni bir viral yük analiz cihazı alındı. Bir kontrol örneğini 50 kez deneyerek ve sonucun ortalamasını ve varyansını değerlendirerek cihazın _____'sını mı kontrol ediyorsunuz?
Güvenilirlik

Azaltılmış penetrasyon?
bir hastalık için genotipe sahip olan ancak hastalık fenotipini hiç sergilemeyen bir bireyde gözlenir.

Hangi çift sarmallı DNA molekülü en yüksek erime sıcaklığına sahiptir?
100.000 baz çiftinden oluşan bir DNA polimeri

Kan dolaşımında bulunan nükleik asitlerin varlığının analizi izlemede önemli midir?
yukarıdaki cevapların hepsi doğru

A260/A280 değeri 2,0 şunu gösterir:
yüksek kaliteli DNA

foliküler lenfomada 18. kromozoma bağlı olan 14. kromozomdan çıkarılan çok miktarda genetik materyal vardır. Buna ne denir?
yer değiştirme

Bir bireyin ebeveyn olarak dışlanması için ebeveynlik testi gerekliliklerinin hariç tutulmasında mı?
test edilen bir bireyde en az iki lokus için zorunlu bir alel bulunmamasını gerektirir.

Bir PCR prosedürü gerçekleştirirken amplikon varlığını kontrol etmek için çalıştırılacak en iyi kontrol nedir?
Banka kontrolü

klinik duyarlılığın değerlendirilmesinde düşük bir duyarlılık oranı mı gösterir?
artan yanlış negatifler

Transfer RNA(tRNA)
ribozomdaki mRNA kodonuna bağlanan antikodon bölgesini içerir.

yanak hücrelerinin alınması için en iyi toplama yöntemi nedir?
ağız boşluğunu durulamak

Prostat kanseri vakalarının yüzde yetmiş beşinin aşağıdaki moleküler ve/veya genetik anormalliklerden hangisini içerdiği bilinmektedir?
kromozomal translokasyon

Bir kromozom üzerindeki belirli bir nükleotid dizisinin yeri, ? olarak adlandırılır. yer

PCR, insan immün yetmezlik ve diğer RNA virüslerinin saptanmasına nasıl uygulanabilir?
Ana karışıma kafa stabil bir ters transkriptaz enzimi ekleme

akut HIV-1 enfeksiyonunun tanısında viral yük testinin kullanımı nedir?
şu anda FDA tarafından onaylanmamıştır

Polimeraz zincir reaksiyonu (PCR) üç süreci içerir. bunların gerçekleştiği sırayı seçin?
Denatürasyon, tavlama, Uzatma

Sitokrom 6450 genlerinin polimorfizmi hangi durumun belirlenmesinde önemlidir?
Zayıf ilaç metabolizması

Minimum özellik boyutu?
bilgisayar çiplerinin üretim sürecinde fiilen oluşturulmuş en küçük bileşenin boyutudur.

SNP'lerle ilgili olarak, uygun olmayan bir sonlandırma(durdurma) kodonu üreten bir baz ikamesi,?
anlamsız mutasyon

Hücre klonalitesi için bir PCR testinin tanısal doğruluğunu değerlendirmek için hazırlanmış bir araştırma çalışması. Çalışma, zayıf tasarımla kusurluydu. aşağıdaki ifadelerden hangileri doğrudur?
sistematik hata arttı

Aşağıdaki polimorfizmlerden birinin birçok alel ve tek bir lokusa sahip olduğu iddia edilen bir ebeveyn DNA'sını bir çocuğun DNA'sı ile karşılaştırırken, yanlış bir şekilde suçlanan bir ebeveyni dışlama olasılığı %90'dan fazla olabilir.

Bir tümör baskılayıcı proteini kodlayan bir genin kaybı, belirli hücreleri neoplastik dönüşüme ve kontrolsüz çoğalmaya yatkın hale getirir. Bu genetik değişiklik sınıfına ne ad verilir?
silme

Aşağıdakilerden hangisi viral yük testinin uygulamalarından biri değildir?
antiviral terapötik ilaçlara direncin değerlendirilmesi

8 ila 80 baz çifti uzunluğundaki bir dizi trinükleotid tekrarından oluşan ve bazen mini uydu dizisi olarak adlandırılan bir polimorfizme ne denir?
değişken sayıda tandem tekrarı (VNTR)

mikrodizi ve makrodizi DNA testi arasındaki fark nedir?
bir makro dizide her hedefin miktarı daha büyüktür

Reddi kontrol etmek için merkaptopurin türevleri alan birçok nakil hastasına hizmet veren bir hastanede farmakogenetik laboratuvarı yönlendirmek üzere seçildiniz. Aşağıdaki enzimlerin polimorfizm deneylerinden hangisi ilgi çekicidir?
TPMT fenotipleme

farmakogenetik ile ilgili olarak bir faz I enzimi ilaçları aşağıdaki yollarla metabolize eder?
infazdan önce suda daha fazla çözünür hale getirmek için oksitleyici substrat

PCR'de denatürasyon nasıl sağlanır?
Sıcaklık

geri dönüş süreleri, moleküler tanı laboratuvarı için bir test menüsü geliştirmede önemli bir husustur. Kısa bir geri dönüş süresi önemlidir ama aynı zamanda?
numune başına analitik maliyeti artırır

Hedef amplifikasyon tekniğinin aksine tek amplifikasyon tekniğine bir örnek olabilir mi?
dallı zincirli DNA tespiti

nükleik amplifikasyon prosedürlerinin rutin otomatik prosedürler haline gelmesine izin veren termostabil bakteriyel enzim izole edildi mi?
termos aquatocus

CF ile ilgili hangi ifade doğrudur?
bazı KF mutasyonları, başka hiçbir belirti olmaksızın erkek kısırlığına neden olabilir

DNA ve RNA arasındaki fark ile ilgili aşağıdaki ifadelerden hangisi doğrudur?
RNA, tipik olarak, çift sarmallı DNA'dan çok daha kısa olan tek sarmallı bir polimer olarak bulunur.

polimeraz zincir reaksiyonunda PCR a ______, Taq polimerazın tek bir DNA zincirini görmesine ve nükleotidleri eklemeye başlamasına izin vererek ilgili dizinin uzatılmasını başlatır?
astar

araştırma laboratuvarlarında yapılan işler ile klinik laboratuvarlarda yapılan işler arasındaki en büyük fark şudur?
klinik laboratuvar çalışmaları kalite kontrol ve kalite güvence önlemleri ile değerlendirilmelidir

çoğalan bir T veya B lenfosit popülasyonunun neoplazi olarak teşhis edilmesi için?
klonalite, immünoglobulin veya T hücre reseptör geninin değişken bölgesinin kısıtlama enzim analizi ile gösterilmelidir.

Heparin, DNA çalışmaları için kullanılacak kan için ideal bir antikoagülan değildir, çünkü?
polimeraz zincir reaksiyonuna müdahale eder

PCR'de kullanılan DNA polimeraz Taq DNA polimerazın benzersiz özelliği nedir?
ısıya dayanıklı

ökaryot hücrede kromozomlar?
en yoğun haldedirler ve metafaz adı verilen hücre bölünmesi aşamasında parmak benzeri yapılar olarak görünürler.

BRCA1 veya BRCA2 mutasyonlarının kalıtımı hangi mekanizma ile meme ve yumurtalık kanseri riskini artırır?
Eksik tümör baskılayıcı fonksiyon

Sindirilmiş elektroforez DNA'sının bir jelden bir naylon zar üzerine aktarılması işlemine ne ad verilir?
Güney lekelenmesi

insanlarda bir genin hangi bileşeni proteine ​​çevrilir?
ekzon

Dolaşımdaki mRNA'nın gözlemlenmesine karşı dolaşımdaki DNA'nın gözlemlenmesinin önemi nedir?
Dolaşan mRNA'nın varlığı, bir mesajın kopyalandığını ve muhtemelen yeni protein senteziyle sonuçlanacağını gösterdi.

40 yaşında bir kadına multipl miyelom teşhisi kondu. Fiziği tavsiye ediyor.. STR lokusları??
Bir numunenin yalnızca donörden olduğunu gösteren sonuçlar genellikle %97 donör olarak rapor edilir ve kararlı kimerizmi gösterir

bir hücre popülasyonu, yüzey belirteçleri CD45, CD3, CD4 ve Tdt için pozitiftir. bunlar hangi tip lökositlerdir?
lenfositler

Aşağıdaki örneklerden hangisinin nükleer DNA verme olasılığı en düşüktür?
saflaştırılmış res kan hücreleri

kırılgan x sendromu ile ilgili olarak tam bir mutasyon genişlemesi anlamına mı geliyor?
>200 CGG tekrarına sahip aleller var

akış sitometrisinde geçitleme terimi ?
sayılacak hücrelerin alt popülasyonunun seçimi

Mikrodizi tespiti için örnek olarak büyük DNA parçalarının kullanılmasıyla ilgili sorunlu bir konu nedir?
kısmi hibridizasyon

hücre çoğalması, foliküler B hücreli lenfomalı kişilerin %90'a varan kısmında meydana gelen BCL2 translokasyonu t(14:18) ile nasıl açıklanabilir?
BCL2 onkogeninin transkripsiyonu, translokasyon ile arttırılır.

DNA, her biri belirli bir görevi olan 3 tip RNA'ya yeniden yazılır:
Messenger RNA (mRNA) protein mesajını sitoplazmaya taşır.
Ribozomal RNA (rRNA), protein sentezinin yeridir.
Transfer RNA (tRNA), amino asit taşınmasından sorumludur.

Bu nükleotid bazlardan hangisi DNA'da bulunur, ancak RNA'da Urasil ile değiştirilir?
timin

Aşağıdaki terimleri en uygun yanıtla eşleştirin:
DNA: Genetik bilgiyi barındıran çift sarmallı polimer
RNA: Timin yerine urasil içeren tek sarmallı polimer
Replikasyon: Ebeveynden yavru hücreye DNA üremesi
Transkripsiyon: DNA'dan oluşturulan RNA mesajı
Çeviri: Protein sentezi için amino asitlere kodlanmış RNA bilgisi

Bir amino asidi tanımlamak için gerekli bilgiyi sağlayan üç bazlı nükleotid dizisine a(n) adı verilir:
kodon

Aşağıdakilerden hangisi moleküler metodolojileri etkileyen preanalitik değişkenlere örnektir?
Uygun hasta tanımlama
Uygun saklama
Antikoagülanların doğru kullanımı

Kan örnekleri alınırken, özellikle PCR yapılırken kaçınılması gereken bir antikoagülan:
heparin

İlgilenilen hedefler şunları içerebilir:
bakteri
RNA
DNA

Aşağıdakilerden hangisi amplifikasyon yöntemine örnek değildir?
BALIK

Aşağıdaki algılama tekniklerini en uygun tanımla eşleştirin:
Floresan:
Daha kısa bir dalga boyunda uyarıldığında daha uzun bir dalga boyunda ışık emisyonu
kemilüminesans:
Kimyasal reaksiyon sonucu ışık enerjisi
Enzim: Floresan veya boya ile kombinasyon halinde kullanılabilir
Elektroforez:
Jel matrisinde elektrik akımı ile hareket

Aşağıdaki adımlardan hangisi doğrudan nükleik asit testinde yer almaz?
Amplifikasyon

Aşağıdaki testleri uygun prensipleriyle eşleştirin:
BALIK
Floresan etiketli bir DNA veya RNA probu ile DNA dizilerinin spesifik boyamasını yaygın olarak kullanan Doğrudan Nükleik asit testi.
bDNA
Sinyal amplifikasyonu ve alkalin fosfataz kullanan sinyal amplifikasyon testi
PCR
Termal döngü ve DNA polimeraz kullanan hedef amplifikasyon testi
LCR
Termal döngü ve DNA ligaz kullanarak hedef amplifikasyon testi
TMA
Ters transkriptaz kullanarak ancak termal döngü olmadan hedef amplifikasyonu

Farklı bir amino asidin kodlanmasına neden olan ikame nükleik asit değişikliğinin adı nedir?
yanlış

Aşağıdakilerden hangisi moleküler testin avantajları olarak kabul edilir?
Artan hassasiyet
Geri dönüş süresi, kültür yöntemlerinden daha hızlıdır

Amplifikasyonda üretilen ürün şu şekilde adlandırılır:
amplikon

Aşağıdaki işlemleri doğru yanıtla eşleştirin:
çoğaltma
Kalıtsal DNA'nın ebeveynden yavru hücrelere geçişi
Tercüme
mRNA'dan bir proteinin oluşumu
Transkripsiyon
DNA'dan RNA mesajına bilgi aktarma işlemi

İki DNA dizisinin eşleşmesi veya tavlanması şu şekilde adlandırılır:
hibridizasyon

Preanalitik değişkenlerle ilgili aşağıdaki ifadelerden hangisi doğrudur?
PCR yöntemleri için antikoagülan olarak heparinden kaçınılmalıdır.

Moleküler yöntemlerin uygulanması şunları içerebilir:
Bulaşıcı hastalık tanımlaması
farmakogenetik
Tümör belirteci algılama
***Yukarıdakilerin hepsi

Bir hibridizasyon hedefini tanımlamak için kullanılan bir nükleik asit şu şekilde adlandırılır: Prob

Bir nükleik asit amplifikasyon yöntemi kullanmanın bir dezavantajı şudur: Özel laboratuvar alanı ihtiyacı

Aşağıdaki RNA'ları en uygun ifadeyle eşleştirin:
tRNA
Amino asit taşınmasından sorumlu
rRNA
Protein sentezinden sorumlu ribozomun bir parçası.
mRNA
Protein mesajını sitoplazmaya taşır.

Aşağıdaki test ilkelerini en uygun yanıtla eşleştirin:
BALIK
Sitoloji/histoloji örneklerinde hedefleri tespit eder
RFLP
Polimorfizmleri tespit etmek için uzun DNA'yı daha kısa parçalara böler
Güney lekesi
Restriksiyon endonükleaz enzimi ve jel elektroforezi kullanır

Bazı amino asitlerin yerleşimlerini yönlendirmek için birden fazla kodonu vardır, buna şu ad verilir:
yozlaşma

Aşağıdakilerden hangisi moleküler amplifikasyon yöntemlerinde kullanılan enzimlerden biri değildir?
amilaz

Aşağıdakilerden hangisi RNA'da bulunan bir nükleotit değildir?
timin

Aşağıdaki çevresel faktörlerden hangisi nükleik asit zincirlerinin ayrılmasına neden olabilir?
Artan sıcaklık

Aşağıdakilerden hangisi direkt nükleik asit testidir?
BALIK

Aşağıdaki test ilkelerini en uygun yanıtla eşleştirin:
bDNA
Alkalin fosfataz kullanarak ve termal döngü olmadan sinyal amplifikasyonu
TMA
Ters transkriptaz kullanarak hedef büyütme. Termal döngüye gerek yok
PCR
DNA polimeraz ve termal döngü kullanarak hedef amplifikasyonu
NASBA
3 enzim kullanarak ve termal döngü olmadan hedef amplifikasyon

Aşağıdaki algılama yöntemlerini en uygun yanıtla eşleştirin:
Enzim
Floresan veya boyalarla birleştirilebilir ve standart kimyasal reaksiyonları kullanır
floresan
Moleküller, daha kısa bir dalga boyunda uyarıldığında daha uzun bir dalga boyunda ışık yayar ve etiketlenmenin yanı sıra lekelenebilir.
kemilüminesans
Kimyasal reaksiyonun ürünü olarak ışık enerjisinin serbest bırakılması
radyoaktivite
Çürümeyi tespit etmek için bir sintilasyon sayacı kullanır
elektroforez
Bir elektrik alanının neden olduğu bir jel matrisinde hareket

Bir PCR amplifikasyon yönteminde aşağıdakilerden hangisi amplifiye edilir?
Hedef

Aşağıdaki değişiklikleri en uygun yanıtla eşleştirin:
yanlış
Farklı bir amino asidi kodlayan bir nükleotit veya dizi ikamesi
SNP
En yaygın değişiklik Tek bir baz değişikliği
silme
Eksik bir nükleotid veya DNA dizisinin başka bir kısmı
sokma
Fazladan bir DNA nükleotidi veya DNA dizisinin başka bir kısmı
Saçmalık
Genellikle bir durdurma kodonu nedeniyle protein üretim sürecinin erken sonlandırılmasıyla sona eren bir nükleotid alt istasyonu.

kromozomların uçlarındaki tekrar eden dizilerin koruyucu birimleri, bir dizi replikasyon olayından sonra somatik hücrelerde azalma eğilimindedir, ancak malign hücrelerde ve enzim kromozomun hücre yaşamını sürdürerek sonunu korur. Bu enzime ne ad verilir?
telomeraz

NDIS bir/
Adli kimlik testinde kullanılan ve 13 çekirdekli kısa ardışık tekrarlanan diziyi kullanan ve karşılaştıran DNA profilleri sistemi.

Aşağıdakilerden hangisi en yaygın polimorfizm türüdür?
tek nükleotid polimorfizmi (SNP)

YILDIZ
tanısal doğruluk çalışmalarının sonucunun raporlanma kalitesini artırmak için tasarlanmış bir projedir.

Öncelikle mikro uydu tekrarları veya tekrarlayan diziler içindeki DNA replikasyon hatasını içeren kolorektal kansere yol açan yol, düzeltilmeden kalır mı?
mikro uydu kararsızlık yolu

Bir DNA probunun floresan veya kemilüminesan sinyal üretmesini sağlamak için hangi süreç kullanılabilir?
proba biyotinlenmiş veya floresan nükleotitlerin ikamesi.

Aşağıdaki dizilerden hangisi sentezlenen bir proteinin translasyonunun durması gerektiğini gösterir?
5' AAC CGA CUC AUC CAG GUA UAG3'

Bir hedef HLA lokus analizindeki tüm alelleri tam amplify PCR ile amplifiye edilecek dizi reaksiyonda kullanılan ____ ile tanımlanır?
primer çiftleri

Belirli genler, örneğin amelogenin geni gibi bir bireyin cinsiyetinin tanımlanması için belirteçler olarak kullanılır. Aşağıdakilerden hangisi cinsiyet belirteçleri olarak da yararlıdır?
Y-kromozom polimorfik belirteçler

Aşağıdaki özelliklerden hangisi hem RNA hem de DNA için ortaktır?
Bir şeker, fosfat kalıntısı ve bir pürin veya pirimidin bazından oluşur.
Fosfodiester bağları ile bağlanır.

Bir fosfat grubu ile biten DNA zinciri 5' ucudur.
NS

Numunelerden nükleik asitleri (DNA ve/veya RNA>) çıkarmak için çeşitli yöntemler vardır. En yaygın protokoller, temelde aynı ilkelere sahip olan manuel veya otomatiktir. Her prensibi sırayla yerleştirin:
Numune materyalinin lizisi. Nükleik asitler serbest bırakılır ve nükleazlar denatüre edilir.
Nükleik asitlerin silikatlar gibi bir zar yüzeyine bağlanması. Bu bağlanma, kaotropik tuz koşulları ve liziz/bağlama tamponunun yüksek iyonik gücü ile kolaylaştırılır.
Artık parçalanmış numuneden zara bağlı nükleik asidin ayrılması.
Birkaç yıkama adımıyla bağlanmamış maddelerin (proteinler, hücre kalıntıları ve PCR inhibitörleri) uzaklaştırılması.
Saflaştırılmış nükleik asidin zardan elüsyonu.

PCR reaksiyonunun ilk adımı nedir?
denatürasyon

Gerçek zamanlı PCR'de hangi aşamada floresan sinyali kaydedilmeye başlayabilir?
üstel faz

Tek nükleotid polimorfizmini (SNP) değerlendirmenin en iyi yollarından biri erime eğrisi analizidir.
NS

Hangisi gerçek zamanlı PCR uygulaması değildir?
Northern blot için DNA amplifikasyonu

RNA'nın üç temel fonksiyonel formu şunları içerir:
haberci RNA'sı
ribozomal RNA
RNA'yı aktarın

Standart veya geleneksel PCR ile mevcut olmayan gerçek zamanlı PCR'nin temel özelliği nedir?
PCR devam ederken DNA amplifikasyonu tespit edilebilir.

RT-PCR prosedüründe tespit için kullanılan spesifik olmayan boyalarla ilgili olarak aşağıdaki ifadelerden hangisi doğrudur? Birden fazla cevap doğru olabilir.
*Bu boyalar floresandır ve çift sarmallı DNA'nın tüm parçalarına bağlanır.
*SYBR green, spesifik olmayan bir boya örneğidir.
*Spesifik olmayan boyalar potansiyel olarak yanlış ölçüme neden olabilir.

PCR'nin her döngüsü sırasında, DNA iki katına çıkar ve hedeflenen DNA parçasının üstel birikimi ile sonuçlanır.
NS

Termocycler, polimeraz zincir reaksiyonu ile DNA ve RNA örneklerini amplifiye etmek için kullanılan araçlardır.
NS

Ters transkriptaz PCR ile ilgili aşağıdakilerden hangisi doğrudur?
*Bir ters transkriptaz enzimi (RTE) kullanır.
*Orijinal RNA örneğini kullanarak DNA'nın bir kopyasını oluşturur.
*HIV hastalarında viral replikasyonun ilerlemesini değerlendirmek için.

HIV hastalarında viral replikasyonun ilerlemesini değerlendirmek.
Çoğullama, aynı numunede aynı anda birkaç farklı DNA veya RNA hedef dizisini test etme PCR işlemidir.
NS

Viral yük tespiti için gerçek zamanlı PCR analizinin en yaygın kullanımları nelerdir?
*Nakil hastalarında enfeksiyonları izlemek için.
*HIV hastalarında viral replikasyonun ilerlemesini değerlendirmek için.

Taq polimeraz aktivitesi için hangi sıcaklık optimal kabul edilir?
72°C

Deoksiribonükleik asit (DNA) şunlardan oluşur:
Adenin
Guanin
sitozin
timin

PCR aşamalarının adlarını tanımlarıyla eşleştirin.
* DNA, tek iplikli DNA ile sonuçlanan hidrojen bağlarını kırmak için ısıtılır.
denatürasyon
*DNA primerleri DNA iplikçiklerine bağlanır.
tavlama
*DNA polimeraz, yeni DNA zincirlerini sentezler.
Uzantı

Gerçek zamanlı PCR'de, erime eğrisi analizi o kadar hassastır ki, DNA moleküllerindeki tek bir nükleotid polimorfizmini (SNP) veya tek nükleotid farkını tespit etmek için kullanılabilir.
NS

Klinik olarak viral yükün belirlenmesi, HIV enfeksiyonlarında spesifik genotipin nasıl tanımlanacağıdır.
YANLIŞ

Döngü eşiği (Ct) değeri, reaksiyondaki PCR ürününün miktarı ile ilişkilidir. Aşağıdakilerden hangileri doğrudur?
Cts < 29, numunede bol miktarda hedef nükleik asidin göstergesi olan güçlü pozitif reaksiyonlardır.
30-37'lik Ct'ler, orta miktarda hedef nükleik asidin göstergesi olan pozitif reaksiyonlardır.
38-40'lık Ct'ler, minimum miktarda hedef nükleik asidin göstergesi olan zayıf reaksiyonlardır.

PCR işlemlerinde hibridizasyonla ilgili EN önemli husus aşağıdakilerden hangisidir?
Hibridizasyon, reaksiyon karışımı sıcaklığı 20-40 saniye boyunca 50-60°C'ye soğutulduğunda meydana gelir.

DNA zincirinin 5' ucu bir OH grubu ile biter.
YANLIŞ

Aşağıda listelenen her bir özelliği geleneksel veya gerçek zamanlı PCR ile eşleştirin.
* Gerçek zamanlı PCR
Tüm amplifikasyon süreci boyunca PCR ürününü ölçer
*Konvansiyonel PCR
Kirlenmeye yol açabilecek birden fazla adım gerektirir
*Konvansiyonel PCR
En yaygın olarak agaroz jel elektroforezi takip eder.
* Gerçek zamanlı PCR
Algılama dahil tüm döngüler aynı tüpte tamamlanabilir

Aşağıdakilerin tümü, otomatik ekstraksiyonun manuel ekstraksiyona karşı büyük avantajı hakkında doğrudur. HARİÇ:
Daha az pahalıdır, ancak artan kontaminasyon riski ile gerçekleştirilmesi daha zordur.

Gerçek zamanlı PCR sonuçları genellikle bir amplifikasyon grafiğinde görüntülenir. Aşağıdakilerden hangisi amplifikasyon grafiği için fazların ilerlemesini tanımlar?
Sabit taban çizgisi, üstel, plato

Başarılı bir Sentez (S) aşamasının sonunda hücrenin kromozomları ______ olur.
iki katına

Hücre döngüsünün Boşluk 1 (G1) aşamasını başlatmak için _______ gereklidir.
Büyüme faktörleri

G1'den S'ye geçişi engelleyen hücresel kontrol noktasına ______ denir.
Retinoblastom proteini (Rb)

Onkogenler, sağlıklı hücreleri kanserli hücrelere dönüştürebilen genler olarak tanımlanır. Lütfen aşağıdaki seçeneklerden onkogen(ler)i tanımlayın:
ERK
Ras
Raf
*Yukarıdakilerin hepsi

Afatinib, Erlotinib ve Gifitinib, _______ mutasyonu için pozitif olan küçük hücreli dışı akciğer kanserini hedefleyen küçük molekül inhibitörleridir.
EGFR

______, sağlıklı hücrelerde anti-proliferatif olduğu için karmaşık bir moleküldür, aksine kanser hücrelerinde, özellikle geç evre kanserde, hücresel proliferasyonu teşvik eder.
TGFB

Apoptozu karakterize eden özellikler arasında ___________ bulunur.
Genel hücre boyutunun küçülmesi
Hücre zarı kabarması
Kromozom yoğunlaşması ve ardından hücre çekirdeği çökmesi
*Yukarıdakilerin hepsi

Kanser hücreleri, telomerlerin ömrünü uzatmak için _______ adlı bir proteini aktive ederek sınırsız büyüme potansiyeline sahip olurlar.
telomeraz

Hücre bölünme süreci genellikle yaklaşık _____ bölünme döngüsünden sonra yavaşlar.
50

Kanser hücreleri _____ yoluyla komşu sağlıklı dokulara ve uzak organlara göç eder.
metastaz

Opdivo ve Keytruda, PD-1'i bloke ederek _______ aktivasyonunu sağlayan FDA onaylı iki ilaçtır.
sitotoksik T hücreleri

Her glikoz molekülü, hücresel yakıt olarak ______ ATP molekülü üretmek üzere dönüştürülebilir.
32

_______, enfekte hücreler veya kanser hücreleri gibi istenmeyen hücreleri içine alabilir ve yutabilir.
makrofaj

Normal hücreler, tam tersine bir glikoz molekülünü parçalayarak _____ ATP molekülü üretir, kanser hücreleri ise bir glikoz molekülünü parçalayarak yalnızca _____ ATP üretir.
32 . 2

Tümör mikroçevresinde birden fazla hücre tipi vardır. Bunlar şunları içerir:
Tümör hücreleri
CAF'ler (kanserle aktive olan fibroblastlar)
TAM'ler (tümörle aktive olan makrofajlar)
*Yukarıdakilerin hepsi

Tümör gelişimi şu şekilde tanımlanan ilerleyici bir süreci takip eder:
Normal --> Hiperplazi --> Displazi --> Karsinoma in situ --> Malignite

Yetim ilaçlar şunları ifade eder:
Nadir hastalıkları tedavi eden ilaçlar

Mayo Clinic çalışmasına göre, iki yıl boyunca günde _____ mg aspirin, kolorektal kanseri %60 oranında azalttığını gösteriyor.
600

_____, sağlıklı koşullar altında bağışıklık tepkisini düzenlemenin yanı sıra anti-proliferatif olduğu gözlenir. Buna karşılık, malignitede _____ kanser hücresi büyümesini ve metastazı teşvik eder.
TGFB

Bir hücre sekiz tur hücre bölünmesinden geçtikten sonra hücre popülasyonu ______ olur.
256

Hücre döngüsünün M aşamasının sonunda, bir anne aynı genetik bilgiye sahip _____ yavru hücreler olur.
2

Kanser hücreleri, daha fazlasını üreterek hücre içi glikoz seviyelerini arttırır:
Glikoz taşıyıcı proteinler

Kanser hücreleri, telomerleri korumak için ______ üreterek ölümsüzleşir.
telomeraz

Kan pıhtılarını azaltmanın yanı sıra ağrı ve ateşi de hafifleten jenerik bir ilaç olan _____, kanser hücresi büyümesini yavaşlattığı için ilacın yeniden kullanılması konusunda büyük bir başarı öyküsüdür.
Aspirin

Kanser hücreleri aşağıdakilerden dolayı kontrolsüz bir şekilde büyür:
Tümör baskılayıcı genlerin mutasyonu ve inaktivasyonu
Onkogenlerin mutasyonu ve aşırı aktivasyonu
Bağışıklık gözetiminden kaçmak
*Yukarıdakilerin hepsi

Fagositoz yapabilen bağışıklık hücreleri şunları içerir:
makrofajlar

Onko-immün tedavide kullanılan FDA onaylı ilacı tanımlayın:
Keytruda

Lütfen küçük hücreli dışı akciğer kanserinde (KHDAK) ve diğer kanser türlerinde bulunan ve sıklıkla mutasyona uğramış bir onkogeni tanımlayın:
EGFR

Lütfen küçük hücreli dışı akciğer kanserinde (KHDAK) ve diğer kanser türlerinde bulunan ve sıklıkla mutasyona uğramış bir onkogeni tanımlayın:
Tip 16, 18, 59, 68

HPV genomunu ve kodlanmış proteinlerini doğru şekilde tanımlayan ifadeyi seçin.
E7 viral kodlanmış protein, konakçı hücre içi protein Rb ile etkileşime girer

HPV'nin neden olduğu çoğu genital kondilom ve servikal lezyon, enfekte bireydeki immün yanıtın bir sonucu olarak düzelir.
NS

Hangi HPV virüs türleri kansere neden olmaz, ancak tüm genital siğillerin %90'ını oluşturur?
Düşük riskli HPV tip 6 ve 11

HPV enfeksiyonu servikal hücrelerde yıllarca oyalanabilir ve sonunda normal hücreleri malign hücrelere dönüştürebilir.
NS

HPV'deki hangi gen veya genler normal viral yaşam döngüsünde E6 ve E7 üretimini kontrol eder?
E2 geni

_____________, genellikle Pap smear'de bir anormallik bulunduğunda serviks, vajina ve vulvanın aydınlatılmış, büyütülmüş görüntüsünü inceleyen ve daha yakından inceleme gerektiren bir tanı prosedürüdür.
kolposkopi

Moleküler test tekniklerinin açıklamalarını gözden geçirin ve doğru ifadeleri seçin.
*Hedef amplifikasyon testleri, belirli bir DNA bölgesinin daha fazla kopyasını yapmak için yöntemler kullanır.
*Denatürasyon, çift sarmallı DNA'yı tek sarmallı DNA'ya dönüştürme işlemidir.

Sıvı servikal sitoloji numunelerinden izole edilmiş yirmi beş DNA numunesi, bir negatif kontrol ve bir pozitif kontrol High-Risk HC 2 DNA testi ile test edilmiştir. Tüm hasta numuneleri ve her iki kontrol de HR-HPV tipleri için pozitifti.
Yıkama adımının ihmal edilmesi

FDA, cobas HPV testine, testin ortak test veya birincil rahim ağzı kanseri tarama testi olarak kullanımını içerecek şekilde genişletilmiş kullanımı için ilk HPV FDA onayını verdi.
NS

Cervista HPV testi FDA onaylıdır ve iki testte (1) 14 HR-HPV tipi için bir HPV tarama testi ve (2) HPV tip 16 ve 18 için bir HPV testinde mevcuttur.
NS

Moleküler tanı testinde, hibridizasyon, sentetik bir ipliğin DNA veya RNA'ya tamamlayıcı baz çifti bağlanmasını kullanır.
NS

Bir HPV enfeksiyonunda viral DNA nerede çoğalır?
Skuamöz epitel hücrelerinde

İnsan genital HPV enfeksiyonunun yaşam döngüsünde, enfeksiyon aşağıdaki durumlardan hangisinde vücut tarafından temizlenebilir?
Enfeksiyon yüzey skuamöz epitel hücrelerinde olduğunda veya enfeksiyon skuamöz epitel hücrelerinin alt katmanlarında üretken hale geldiğinde.

İki ana prosese dayanan hangi FDA onaylı HPV testi 1) HPV ve hücresel DNA'yı aynı anda ekstrakte etmek için otomatik numune hazırlama ve (2) hedef DNA dizilerinin PCR amplifikasyonu, bir ortak test olarak kullanım için genişletilmiş FDA onayı verilmiştir. Primer serviks kanseri tarama testi?
Cobas HPV Testi

Güncellenmiş 2018 servikal tarama kılavuzlarını tanımlarken aşağıdaki ifadelerden hangisi doğrudur? (Birden fazla seçenek doğru olabilir).
21 yaşın altındaki kadınlara rahim ağzı kanseri taraması yapılmamalıdır. Bununla birlikte, bir kadın cinsel olarak aktif hale geldiğinde Pap testi ile tarama yapılması önerilir.
21-29 yaş arası kadınlar, HPV testi ile değil, Pap testi veya sıvı bazlı sitoloji kullanılarak her 3 yılda bir taranmalıdır.
2018'de USPSTF, 30 ila 65 yaş arasındaki kadınlar için birincil tarama testi olarak HPV testinin (hrHPV) bir seçenek olarak kullanılmasını önerdi.
Bir seçenek olarak, 30-65 yaş arası kadınlar, her beş yılda bir HPV ve Pap testleri kullanılarak birlikte test yaptırabilirler.

Aşağıdaki genlerden hangisi DNA sentezini BAŞLATIR, hücre bölünmesini teşvik eder ve hücre ölümünü engeller?
proto-onkogenler

Hedefin saptanmasına izin vermek veya hedefin yeterli kopyalarını sağlamak için birçok moleküler tahlilde ne kullanılır?
Amplifikasyon

Aşağıda listelenen tanımlar moleküler testlerde kullanılan terimleri tanımlar. Her tanımı, tanımladığı açılır kutudaki terimle eşleştirin.
Oligonükleotid: Kısa bir sentetik nükleik asit zinciri
Prob: Etiketlendiği ve tamamlayıcı diziyi tanımlamak için kullanılan başka bir nükleik asit dizisine tamamlayıcı olan bir nükleik asit parçası.
Hedef: Moleküler test yöntemiyle tespit edilen organizmaya, mutasyona veya hastalığa özgü belirli bir DNA veya RNA bölgesi

HPV E6 ve E7 kodlu proteinler aşağıdaki nedenlerden hangisi için önemlidir?
Normal konakçı hücreleri malign hücrelere dönüştürürler.

İnsan papilloma virüsü (HPV), her zaman bir hastalık durumuna ilerleyen, nadir görülen, nadiren ortaya çıkan bir enfeksiyondur.
YANLIŞ

Bir kadına HPV virüsü bulaşmışsa, aşağıdakilerden hangisi serviks kanseri gelişme riskinin artmasıyla ilişkilidir?
SİGARA İÇMEK

Denatürasyon: İlk olarak, DNA şablonunu içeren reaksiyon karışımı, çift sarmallı DNA'yı tek sarmallara ayırmak veya denatüre etmek için ısıtılır.
Tavlama: Reaksiyon karışımı daha sonra primerlerin DNA şablonuna bağlanmasına veya bağlanmasına izin vermek için soğutulur.
Uzatma: Son olarak, polimeraz, primerlerden (uzatma.

Temel bir PCR reaksiyonu aşağıdaki şekilde çalışır:
İlk olarak, primer olarak adlandırılan iki kısa DNA dizisi, DNA hedefinin başlangıcına (3') ve sonuna (5') bağlanacak şekilde tasarlanmıştır. Primer nükleik asit dizileri, hedef bölgeyi kuşatmak için seçilir, böylece amplifikasyonda hedef artar.
PCR gerçekleştirmek için hedefi içeren DNA şablonu, primerler, serbest nükleotitler (adenin, guanin, sitozin, timin), [bunlara deoksiribonükleotid trifosfatlar (dNTP'ler) olarak da adlandırılır] ve bir enzim içeren bir tüpe eklenir. DNA polimeraz.
Bu karışım bir PCR makinesine yerleştirilir. PCR makinesi, örneğin sıcaklığını otomatik, programlanmış adımlarla artırır ve azaltır.
Başlangıçta karışım, çift sarmallı DNA şablonunu tek sarmallar halinde denatüre etmek veya ayırmak için ısıtılır (örneğin, 95°C). Karışım daha sonra soğutulur (örneğin 60-65°C), böylece primerler DNA şablonuna tavlanır (bağlanır).
Son olarak, DNA polimerazı optimize etmek için sıcaklık yaklaşık 72°C'ye yükseltilir ve primerlerden (uzatma) başlayarak yeni DNA ipliklerini sentezlemek için nükleotidlerin eklenmesini katalize eder. İlk döngünün sonunda, her çift sarmallı DNA molekülü, bir yeni ve bir eski DNA zincirinden oluşur.
PCR daha sonra yukarıda belirtilen adımları tekrar eden ek döngülerle devam eder. Yeni sentezlenen DNA segmentleri, DNA hedefinin milyonlarca kez katlanarak amplifiye edilmesini sağlayan sonraki döngülerde şablon görevi görür.

Bir PCR reaksiyonunun sıralı adımları nelerdir?
Denatürasyon: İlk olarak, DNA şablonunu içeren reaksiyon karışımı, çift sarmallı DNA'yı tek sarmallara ayırmak veya denatüre etmek için ısıtılır.
Tavlama: Reaksiyon karışımı daha sonra primerlerin DNA şablonuna bağlanmasına veya bağlanmasına izin vermek için soğutulur.
Uzatma: Son olarak, polimeraz, primerlerden (uzatma) başlayarak yeni DNA zincirlerini sentezlemeye başlar.

Olgunlaşmamış bir B hücresi bir antijene maruz kalırsa, ağır zincir genleri, spesifik antikor molekülleri üretmek için yeniden düzenlenebilir. buna denir?
somatik hipermutasyonlar

DNA veya RNA'nın bir hedef dizisini saptamak için bir multipleks PCR tahlili kullanılır. Bu tahlil, belirli bir virüs veya bakteriyi tespit etmek veya bir bireyin ilgili bir gene sahip olup olmadığını belirlemek için kullanılabilir.
FAZ

Multipleks PCR tahlillerinin sonuç üretmesi genellikle geleneksel kültür yöntemlerine göre daha uzun sürer.
FAZ

Primerler, PCR ile DNA'nın hangi bölgesinin amplifiye edileceğini belirleyen faktör olduğundan, primerin hedefe spesifik olmaması gerekir.
FAZ

Primerler genellikle kaç baz çiftinden (bp) oluşur?
18-22 kan basıncı

Erime sıcaklığı (Tm), DNA'nın ayrı nükleotidlerine parçalandığı sıcaklıktır.
FAZ

Doğrulama, değiştirilmemiş FDA onaylı bir tahlille uğraşırken kullanılan terimdir.
Validasyon, FDA tarafından onaylanmayan bir testle uğraşırken kullanılan terimdir (laboratuvarda geliştirilen test [LDT])

Numune toplama: Bir temsilcinin, doğrulanmış numunenin işlendiğinden ve bol miktarda nükleik asit bulunduğundan emin olun.
Nakil: Nükleik asitlerin stabilitesini korumak için yerinde bir sistem olduğundan emin olun (örneğin, buz üzerinde veya uygun olduğunda RNA stabilize edilmiş ortam ile).
Saklama: Numune hemen işlenmezse, saklama en yaygın olarak -80°C'de gerçekleşir.
Örnek işleme: Standart Önlemlere uyun.
Nükleik asit ekstraksiyonu: Uygun olduğunda manuel veya otomatik ekstraksiyon kullanın.
Kontaminasyon: Muhafazayı optimize eden ve işlem sonrası dekontaminasyona (örneğin etanol ve ağartıcı) yapışan uygun bir ortama sahip olarak kontaminasyonu önleyin.

Doğruluk - üreticinin iddialarını karşılayabilir misiniz? Bilinen değerlere sahip mevcut kalibratörler/kalibrasyon ve kalite kontrol materyali, bilinen değerlere sahip yeterlilik test materyali ve bilinen değerlere sahip önceden test edilmiş numuneler kullanın. Genel olarak, 10 pozitif ve on negatif örnek, doğruluğu belirlemek için yeterlidir.
Kesinlik - laboratuvar aynı örnekleri üç farklı günde üç farklı operatörle (teknologlar) tekrar tekrar test edebilir ve aynı veya karşılaştırılabilir sonuçları alabilir mi?
Raporlanabilir aralık - ne kadar yüksek ve ne kadar düşük test sonuçları doğru bir şekilde belirlenebilir? Genel olarak, en yüksek ve en düşük üreticinin doğruluk iddiasına göre bilinen değerlere sahip numuneleri seçin. Sonuçlar yalnızca bu aralık için raporlanabilir.

Doğruluk, PCR sonuçları ile "bilinen" pozitif referans sonuçları arasındaki korelasyondur. Bunlar ticari olarak (analiz sertifikaları ile) veya referans laboratuvarlardan veya aynı testleri yapan meslektaşlarından elde edilen numuneler olabilir. Hedeflerin değişen seviyelerini test etmek önemlidir.
Bir analitik prosedürün kesinliği, kesin tahlil koşulları altında gerçekleştirilen homojen numunenin çoklu örneklemesinden elde edilen bir dizi ölçüm arasındaki uyumdaki korelasyondur. Aşağıdakiler dahil olmak üzere üç hassasiyet seviyesi vardır:
Tekrarlanabilirlik: Kısa bir zaman aralığında aynı çalışma koşulları altında kesinliği ifade eder. Tekrarlanabilirlik aynı zamanda analiz içi kesinlik olarak da adlandırılır.
Ara kesinlik: Laboratuvar içi varyasyonları ifade eder (örneğin, farklı günler, farklı analistler, farklı ekipman, vb.).
Tekrarlanabilirlik: Laboratuvarlar arasındaki kesinliği ifade eder (genellikle metodolojinin standardizasyonu için uygulanan ortak çalışmalar).

Aşağıdaki tahlil doğrulama parametresi tanımlarını tanımladıkları parametrelerle eşleştirin.
*Hassasiyet: Kesin test koşulları altında gerçekleştirilen homojen numunenin çoklu örneklemesinden elde edilen bir dizi ölçüm arasındaki uyumdaki korelasyon.
*Klinik özgüllük: Söz konusu hastalık/test parametresine sahip olmayan hastalar için bir testin NEGATİF sonuç verme yeteneği.
*Klinik duyarlılık :Söz konusu hastalık/test parametresine sahip hastalar için bir testin POZİTİF sonuç verme yeteneği.
*Doğruluk: PCR sonuçları ile KNOWN pozitif referans sonuçları arasındaki korelasyon.
*Hedefler: Spesifik gen dizilerini tanımlamak için hesaplanmış nükleotid bileşenleri.

Primerlerin hepsi aynı erime sıcaklığına sahiptir.
YANLIŞ

Bir testin amaçlanan amaca uygunluğunu değerlendiren çok aşamalı sürece ne denir?
doğrulama

PCR reaksiyonunun hedefi nedir?
Çift sarmallı DNA

Multipleks PCR testi solunum panellerinin hastalara sağladığı fayda aşağıdakiler tarafından belgelenmiştir:
Antibiyotik kullanım süresini azaltın.
Yatarak tedavi süresini kısaltın.
İzolasyonda geçirilen zamanın azalması.

Multipleks PCR testi kullanan gastrointestinal (GI) paneller, bakteriyel, viral ve paraziter enfeksiyon ajanlarının saatler içinde saptanmasını ve ayırt edilmesini sağlar.
NS

Analitik özgüllük nasıl tanımlanır?
Bir tahlilin amaçlanan hedefi tespit etme yeteneği.

DNA replikasyonu için gerekli olan anahtar enzim hangisidir?
DNA polimeraz

Multipleks testler için primerleri tasarlarken ve seçerken aşağıdakileri dikkate almak önemlidir:
astar tasarımı
Primer tavlama sıcaklığı
astar konsantrasyonu
dNTP'ler, magnezyum klorür (MgCl2), polimeraz ve tuzların konsantrasyonu

Taq DNA polimeraz için ideal sıcaklık nedir?
72°C

Geleneksel bir PCR döngüsünün üç temel adımı nelerdir?
Denatürasyon, tavlama ve uzatma

Algılama sınırı ne ile eş anlamlıdır?
Analitik duyarlılık

Numune hemen işlenemiyorsa numuneyi saklamak için EN İYİ sıcaklık nedir?
-80ºC

Bir multipleks PCR tahlilini doğrulamak için doğru sıra nedir?
Hedefleri, analitik duyarlılığı, analitik özgüllüğü, doğruluğu, kesinliği tanımlayın

Multipleks PCR testinin uygulanmasının en zorlu yönlerinden biri, doğrulama ve doğrulama süreci için yeterli kontrol materyali elde etmektir. Bunlar, aşağıdaki HARİCLERİN tümünden elde edilebilir:
Hasta örneklerinden bilinmeyen değerler

Tek bir reaksiyon tüpünde amplifikasyon ile iki veya daha fazla hedef DNA veya RNA dizisini tespit etmek için bir multipleks PCR kullanılır. Tek bir çalışmada daha fazla hedefin tespit edilmesini sağlayan birden fazla primer ve prob seti reaksiyona eklenir.
NS

Primer erime sıcaklığı (Tm) formülü: Tm = 4(G+C) + 2(A+T)
PCR primeri 5'-AATCCAGGTATTCGCGAAG-3' için erime sıcaklığı nedir?
56°C

Multiplex PCR kullanmanın avantajlarından bazıları şunlardır:
Daha az örnekle daha fazla bilgi
Daha yüksek verim
Uygun maliyetli (daha az dNTP, enzim ve diğer sarf malzemeleri)
Zaman tasarrufu (geleneksel kültür yöntemlerine karşı)
Daha az girdi malzemesi gerekli
Sınırlı başlangıç ​​malzemelerinden daha fazla veri
Artan veri analizi doğruluğu
Daha az pipetleme hatası
Kontaminasyon olasılığını azaltmak için kapalı bir ortamda gerçekleştirilir

Hangi ifade sıvı biyopsi testini doğru tanımlar?
Sıvı biyopsi tipik olarak dolaşımdaki kanser hücrelerini veya bir kan örneğinde bulunan bir kanserin RNA veya DNA'sının izlerini analiz eder.

Tipik olarak, %0,1 veya daha düşük bir popülasyon frekansında meydana gelen dizi varyasyonları, bireysel tanımlama için incelenir. Bir kimlik testi laboratuvarında, popülasyonda yaklaşık %2 sıklıkta bir genetik dizi varyantının meydana geldiği bulundu. Bu tür bir dizi varyantı olarak adlandırılır?
polimorfizm

kafeini metabolize eden asetilleyici enzim nedir?
N-Asetiltransferaz (NAT)2

Kanser hastaları için doku biyopsisi, kanserin mutasyonlarını ve malignite derecesini saptamak için kullanılan standart bir prosedürdür.
NS

Doku biyopsisi ile karşılaştırıldığında sıvı biyopsinin avantajları nelerdir?
A. Sıvı biyopsi, doku biyopsisine kıyasla çok daha az invazivdir.
B. Sıvı biyopsi genellikle doku biyopsisinden çok daha az maliyetlidir.
C. Sıvı biyopsi potansiyel olarak erken tanı koymak için kullanılabilir.
D. Sıvı biyopsi, metastatik nüks veya metastatik ilerleme riskini tahmin etmek için kullanılabilir.
**E. Yukarıdaki tüm seçenekler (A, B, C ve D) sıvı biyopsinin avantajlarıdır.

Dolaşan tümör hücreleri (CTC'ler), birincil tümörden ayrılan ve kan dolaşımında dolaşan hücrelerdir.
NS

Metastatik hastalığı olan hastalarda, CTC'ler tipik olarak, tam kanın mL'si başına CTC'nin hangi mertebesinde sıklıkta bulunur?
Tam kanın mL'si başına 1-10 CTC

Dolaşımdaki tümör DNA'sı (ctDNA) için aşağıdaki ifadelerden hangisi doğrudur? (Uygun olan tüm seçenekleri işaretleyin.)
*Normalde, ölü ve ölmekte olan hücreler süzülür ve kan dolaşımından fagositler tarafından temizlenir. Ancak bu süreç, kötü huylu hücreler için o kadar etkili değildir ve ctDNA'nın kan dolaşımına salınmasıyla sonuçlanır.
*Klinik olarak, bir hastanın kan dolaşımındaki nispi ctDNA seviyelerinin tümör yükü ile korele olduğu, tümör büyüdükçe arttığı ve tedaviye yanıtla azaldığı gösterilmiştir.

Eksozomlar, pıhtılaşmada kilit rol oynayan ve tümörlerden kana salındığı bilinen vücut sıvılarındaki hücre kaynaklı veziküllerdir.
NS

Eksozomların klinik önemi ve önemi ile ilgili aşağıdaki ifadelerden hangisi doğrudur?
Eksozomlar potansiyel olarak prognoz, terapi ve sağlık ve hastalık için biyobelirteçler olarak kullanılabilir.

____________ tıp, hastalığı önlemek, teşhis etmek ve tedavi etmek için bireyin genetik profilini, protein yapısını ve çevresini kullanır.
Kişiselleştirilmiş

Tipik bir sıvı biyopsi testi gerçekleştirirken atılan adımlar ile ilgili olarak, aşağıdaki ifadelerden hangisi YANLIŞTIR?
Amplifikasyon ve dizilemeye yönelik hedeflenen yaklaşımda, yöntem tüm genleri sorgulamak için kullanılır ve tümör DNA'sındaki yeni mutasyonları keşfetmek için tüm genomu veya tüm ekzom dizilimini içerir.

CELLSEARCH® CTC sıvı biyopsi testini tanımlarken hangi ifade YANLIŞTIR?
CELLSEARCH®, ctDNA için klinik olarak onaylanmış, FDA onaylı ilk sıvı biyopsi testidir.

Metastatik meme kanseri (mBC) hastası için bir CELLSEARCH® Test sonucu sekiz (8) CTC olarak rapor edildi. Bu sonuç nasıl yorumlanır?
Olumsuz bir yanıt.

CELLSEARCH® Testinin test sonuçları, belirli metastatik kanserler için olumlu ve olumsuz prognozu gösteren CTC seviyeleri olarak rapor edilir. Aşağıdaki seçimlerden hangisi metastatik kolorektal kanserli (mCRC) bir birey için olumlu bir sonuç olarak kabul edilir?
2 CTC

cobas® EGFR Mutasyon Testi v2, bir EGFR tirozin kinaz inhibitörü (TKI) ile tedavi seçiminde yardımcı olarak küçük hücreli olmayan akciğer kanseri (NSCLC) hastalarında EGFR mutasyonlarını saptamak için FDA tarafından onaylanmıştır.
NS

Boşluğu doldurun: ExoDx™ Akciğer(ALK) testi, kan örneklerinde bulunan eksozomal __________ izole eder ve analiz eder ve akciğer kanseri hastalarının plazmasında EML4-ALK füzyon transkriptlerini tespit eder.
RNA

ExoDx™ Lung(ALK) testi, ALK inhibitör tedavilerine yanıtı tahmin edebilen EGFR-ALK gen füzyonunu tanımlamak için tasarlanmış, eksozom bazlı bir klinik sıvı biyopsi testidir.
YANLIŞ

ExoDx™ Lung(ALK) testinde kullanılan exoRNeasy sistemi nedir?
Plazma, serum veya diğer biyolojik sıvılarda bulunan hücre dışı veziküllerden (eksozomlar) ekstraselüler RNA'yı (ekzoRNA) konsantre etmek ve saflaştırmak için tek kullanımlık döndürme kolonları kullanan bir sistemdir.

Hangi ifadeler DOĞRU? (Uygun olan tüm seçenekleri işaretleyin.)
*Sıvı biyopsi testlerindeki büyümeye, yeni nesil dizileme (NGS) gibi teknolojik gelişmeler yardımcı oldu.
*Likit biyopsi tahlillerinin birincil sınırlamalarından biri, testin klinik kullanımı için destek eksikliğidir.
*Sıvı biyopsilerin değeri, kanserin ilerlemesi için seri izlemede ve belirli bir tedavinin terapötik yararlarını değerlendirmede görünmektedir.

Yardımcı tanılama terimini tanımlarken hangi ifadeler DOĞRU?
***E. Hem C hem de D doğrudur.
C. Yardımcı teşhis, ilaçla ilgili farmakogenomik bilgileri kullanır ve hastanın optimal tedavi kararlarına yardımcı olmak için bu bilgileri ilacın reçete etiketine yerleştirir.D. Yardımcı teşhis, bir doktorun, hastanın genomik yapısına dayalı olarak tedavi ilaçları konusunda daha iyi kararlar vermesine olanak tanır.

CELLSEARCH® Testi, dolaşımdaki tümör hücreleri (CTC'ler) için klinik olarak doğrulanmış, FDA onaylı ilk sıvı biyopsi kan testidir ve CTC'leri yakalamak, izole etmek ve numaralandırmak için benzersiz bir immünomanyetik teknoloji kullanır.
NS

Sıvı biyopsi tahlil teknolojisinde birçok varyasyon vardır. Bu moleküler biyobelirteçlerden hangileri tipik olarak piyasada bulunan sıvı biyopsi kitlerinden biri kullanılarak plazmadan ekstrakte edilir?
*F. A, B ve D şıkları doğrudur.
A. Dolaşan tümör hücreleri (CTC'ler)
B. Dolaşan tümör DNA'sı (ctDNA)
D. Eksozomlar

Hangi ifade dolaşımdaki tümör DNA'sı (ctDNA) ile hücresiz DNA (cfDNA) arasındaki farkı doğru bir şekilde tanımlar?
C. Her ikisi de kan dolaşımında dolaşır. ctDNA, bir tümörden dökülen DNA parçalarıdır, cfDNA ise serbestçe dolaşan, ancak mutlaka tümör kaynaklı olmayan DNA'dır.

Sıvı biyopsinin kullanılması, kişiselleştirilmiş tıbbın, tümörün özelliklerine göre kişiselleştirilmiş bir tümör tedavisi reçete edilmesine yol açabilecek genetik mutasyonları tanımlaması için büyük umut vaat ediyor.
NS

Aşağıdaki ifadelerden hangisi sıvı biyopsi testinin bir sınırlamasını tanımlamaz?
A. Sıvı biyopsinin gerçekleştirilmesi tipik olarak geleneksel doku biyopsisinden daha pahalıdır.

Sıvı biyopsi, potansiyel olarak bireysel bir hasta için tüm tümör yükünün kapsamlı, gerçek zamanlı bir değerlendirmesini sağlayabildiğinden, birçok uzman standart doku biyopsisinin yerini alma potansiyeline sahip olduğuna inanmaktadır.
NS

Droplet Digital™ PCR (ddPCR™) teknolojisi nedir?
*E. Yukarıdaki tüm seçenekler doğrudur (A-D).
A. Teknoloji, tümör DNA'sı ile ilişkili nükleik asitlerin yüksek düzeyde hassas ve mutlak miktar tayinine izin verir.
B. Kandan alınan nükleik asit numuneleri, bir su-yağ emülsiyon sistemi kullanılarak binlerce damlacıklara bölünür.
C. Her damlacık, nükleik asit amplifikasyonu için küçük, ayrı bir test odası görevi görür.
D. Amplifikasyon, tüm damlacıklarda aynı anda gerçekleşir ve damlacıkları saymak için floresan algılamayı kullanır.

Tipik bir sıvı biyopsi tahlilindeki adımlardan biri, ctDNA, CTC'ler ve eksozomların analizidir. Analiz adımını tanımlarken aşağıdakilerden hangisi DOĞRUDUR?
*E. Yukarıdakilerin tümü doğrudur (A-D).
A. Analiz, amplifikasyon ve sıralama yoluyla yapılır.
B. Amplifikasyon ve dizileme genellikle gelişmiş yeni nesil dizileme (NGS) ve/veya polimeraz zincir reaksiyonu (PCR) teknolojileri kullanılarak gerçekleştirilir.
C. Amplifikasyon ve dizileme için "hedefli" yöntemi kullanırken, amaç tüm genleri sorgulamaktır.
D. "Hedefli" yaklaşım, sıvı biyopsileri standart birincil doku biyopsileri ile birleştirerek daha kişiselleştirilmiş, hedefli analize olanak tanır.

Dolaşan tümör hücreleri (CTC'ler) ilk olarak 1869'da metastatik bir hastada gözlendi. On yıldan daha kısa bir süre içinde, araştırmacılar hem sağlıklı hem de hastalıklı hastalarda hücresiz DNA'yı (cfDNA) tespit edip nicelleştirebildiler.
YANLIŞ

Aşağıdakilerden hangisi DOĞRU ifadelerdir?
*Trizomi, belirli bir kromozomun normal iki kopyası yerine üç kopyasının olduğu bir anöploididir.
*Down sendromu, aynı zamanda trizomi 21 olarak da bilinir, bir bireyde fazladan bir kromozom 21 kopyası olduğunda ortaya çıkar.

Turner sendromu, erkeklerde gelişimi etkileyen ve fazladan bir X kromozomunun varlığının sonucu olan bir cinsiyet kromozomal durumudur.
YANLIŞ

Down sendromu ile ilgili hangi ifadeler DOĞRU?
*Etkilenen birey, trizomi 21 olarak adlandırılan 21. kromozomun üçlü bir kopyasına sahip olacaktır.
*Durum doğuştan kalp kusurları ile ilişkilidir.
*Sağlık belirtileri ve koşulları, bazılarında (varsa) az sayıda sağlık sorunu olan Down sendromlu bireyler arasında değişiklik gösterebilir.
*Down sendromlu bireylerin yaşam beklentisi şu anda yaklaşık 60 yıldır.

Down sendromunun kesin tanısı, fazladan bir 21 numaralı kromozomun varlığının tanımlanmasını içerir.
NS

Konjuge olmayan estriol (uE3-estriol) ve dimerik inhibin A (DIA), hamileliğin ikinci trimesterinde anne serumu üzerinde gerçekleştirilen dörtlü doğum öncesi tarama panelinin (dörtlü tarama) parçası olan testlerden ikisidir. Dörtlü ekranda aşağıdaki testlerden hangisi de yer alır?
*Anne serumu alfa-fetoproteini (MS-AFP)
*Beta-HCG

Sınırlı plasental mozaikçiliği (CPM) tartışırken hangi ifadeler doğrudur?
*CPM, fetüsün kromozomal/genetik yapısı ile plasenta arasındaki uyumsuzluktan kaynaklanan bir durumdur.
*CPM tipik olarak CVS prosedürü ile teşhis edilebilir.
*CPM, CVS prosedürünün sitogenetik olarak belirsiz sonuçlar vermesine neden olabilir.

Hücresiz fetal DNA (cffDNA) testi ile ilgili aşağıdaki ifadelerden hangisi DOĞRUDUR?
*cffDNA, büyük ölçüde paralel dizileme (MPS) tekniği veya hedeflenen DNA analizi kullanılarak anne plazmasında tespit edilebilir.
*MPS tekniği, milyonlarca hücresiz DNA (cfDNA) fragmanını analiz eder.
Geri bildirim

Aşağıdaki ifadelerden hangisi, fetal anöploidi için şu anda mevcut olan ticari cfDNA doğum öncesi testlerini doğru bir şekilde tanımlamaktadır?
*MaterniT21® PLUS ve Verifi® doğum öncesi testleri, büyük ölçüde paralel sıralama (MPS) teknolojisini kullanır.
*Harmony® doğum öncesi testi, seçilen bölgelerin dijital analizi için hedeflenen DNA analizini ve DANSR tekniğini kullanır.

Toplu paralel imza dizileme (MPSS) tekniğindeki İLK adım, _________'nin in vitro klonlanmasını içerir.
cDNA parçaları

Down sendromunu teşhis etmek ve/veya invaziv bir prosedür olmasına rağmen durumu ekarte etmek için hangi testin son derece doğru olduğu kabul edilir?
Fetal kromozom anormallikleri için amniyosentez testi

Down sendromu, 21. kromozomun üç katına çıkmasından kaynaklanır.
NS

Edwards sendromu, Trizomi 13 olarak da bilinir.
YANLIŞ

16-18. gebelik haftalarında anne serumu üzerinde gerçekleştirilen dörtlü bir tarama (dörtlü tarama), bu test sonuçları kombinasyonuna sahipse Down sendromu riskinin arttığını düşündürür (aşağıdaki her test için açılır listeden "artırıldı" veya "azaldı"yı seçin):
*ArtmışAnne serumu HCG ((MS-HCG)
*Azalan Konjuge olmayan estriol (UE3-estriol)
*ArtırılmışDimerik inhibin A (DIA)
*Azalmış Anne serumu alfa-fetoproteini (MS-AFP)

Hücresiz fetal DNA (cffDNA) doğum öncesi testi ile ilgili hangi ifade YANLIŞTIR?
Negatif bir test sonucu, fetal anöploidi olmamasını sağlar.

cfDNA kullanılarak yapılan NIPT testi şu anda tanısal olarak kabul edilmemektedir ve pozitif NIPT sonucu olan kadınlara teyit için CVS veya amniyosentez gibi invaziv testler önerilmelidir.
NS

Aşağıdaki terimlerden hangisi "anormal (artan veya azalan) kromozom sayıları" olarak tanımlanabilir?
anöploidi

Fetal DNA'yı maternal DNA'dan izole etmeye yönelik kitlesel paralel imza dizileme (MPSS) tekniği, numune başına çok sayıda DNA parçasının analizini gerektirir.
NS

Gebeliğin İLK üç aylık döneminde yapılan Down sendromu riski için anne serumu tarama testleri genellikle hangi iki biyobelirtecin ölçümünü içerir?
*Ücretsiz beta insan koryonik gonadotropini (Ücretsiz beta HCG)
*Gebeliğe bağlı plazma protein A (PAPP-A)

ACOG tavsiyeleri ve/veya hücresiz DNA testi kılavuzlarına göre aşağıdaki ifadelerden hangisi doğrudur?
*cfDNA test sonucu pozitif olan bir hasta için tanı testi önerilmelidir.
*cfDNA taraması çoğul gebeliği olan kadınlar için önerilmez.
*Ultrasonda fetal yapısal anomali tespit edilirse, cfDNA taraması yerine tanısal testler önerilmelidir.

Gebeliğin birinci veya ikinci trimesterinde ölçülen bu biyobelirteçlerden hangisi yumurtalık tarafından salgılanır ve hipofiz bezi tarafından folikül uyarıcı hormon (FSH) üretimini engeller?
inhibin A

Down sendromu veya diğer trizomi riskini belirlemek için kullanılan anne serumu doğum öncesi üçlü veya dörtlü tarama paneli talebine hangi bilgilerin dahil edilmesi gerekir?
Örnek toplama sırasındaki gebelik yaşı
anne doğum tarihi
Hastanın ırkıAnne ağırlığı
Varsa diyabeti kontrol etmek için ilaç kullanımı (örn. insülin)
Varsa, çoğul gebeliklerin (ör. ikizler) klinik kanıtı
*Yukarıdakilerin hepsi

Hücresiz DNA (cfDNA) NIPT testi tartışılırken aşağıdaki ifadelerden hangisi DOĞRUDUR?
Herhangi bir cfDNA NIPT testinin doğruluğu, anne kanında bulunan toplam cfDNA'nın fetal fraksiyonuna bağlıdır.
Çoğu NIPT tahlili, yeterli düzeyde cffDNA (fetal fraksiyon) sağlamak için on hafta veya daha fazla gebeliği olan hamile kadınlar üzerinde test yapılmasını önerir.
Anne boyutu, özellikle yüksek anne vücut ağırlığı, daha düşük fetal fraksiyonla sonuçlanan seyreltme etkisine neden olabilir.
Sınırlı plasental mozaikliğin (CPM) veya kaybolan bir ikizin varlığı, NIPT testi yapılırken yanlış pozitif sonucun ortaya çıkmasına neden olabilir.
**Yukarıdakilerin tümü

Aşağıdaki ifadelerden hangisi Alzheimer Hastalığını (AH) doğru tanımlar?
*AH yaşlılarda en sık görülen bunama şeklidir.
*AH, geri dönüşü olmayan ve ilerleyici bir beyin hastalığıdır.
*ABD'de 65 yaş ve üzerindeki her 10 kişiden birinde AD vardır.

Alzheimer Hastalığının (AH) hangi "evresi" tipik olarak en uzundur (çoğunlukla uzun yıllar sürer) ve kişi görevleri yerine getirmekte güçlük çeker, ancak yine de yaşamla ilgili ayrıntıları hatırlar?
Ilıman

Alzheimer Hastalığının (AH) genetik, yaşam tarzı ve çevresel faktörlerin bir kombinasyonundan kaynaklandığına inanılmaktadır.
NS

AD tanısı ile ilgili hangi ifadeler doğrudur?
*Şu anda AD'yi teşhis etmek için tek bir kesin tanı testi yoktur.
*Beyin dokusunun mikroskobik incelemesi kullanılarak kişinin ölümünden sonra kesin tanı konulabilir.
*AH teşhisi tipik olarak durumu ekarte etmek için dışlama veya diğer testler kullanılarak yapılır.
*Hastanın tıbbi öyküsü ve mental durum muayenesi tanısal yaklaşımın bir parçası olarak kullanılır.

Hangi spesifik PET taraması türü beyindeki nörofibriler yumakları ölçer?
evcil hayvan

AD gelişiminde rol oynayan belirli genlerin genetik testleri mevcuttur ve bu tür genetik testlerin rutin AD değerlendirmesi için kullanılması artık tavsiye edilmektedir.
YANLIŞ

AD vakalarının küçük bir yüzdesinde, belirli genlerde meydana gelen genetik mutasyonlar doğrudan AD'ye neden olabilir. Bu genlere verilen ad nedir?
Deterministik Genler

AD için biyobelirteçlerle ilgili olarak hangi ifadeler doğrudur?
*Biyobelirteçler hem BOS hem de kanda incelenmiştir.
*Biyobelirteçler, potansiyel tedavilerin erken tespiti, önlenmesi ve etkileri ile ilgili araştırma çalışmalarına yardımcı olmak için kullanılmıştır.

Plaklarda biriktiğinde hangi peptit BOS'ta düşük seviyelerde bulunabilir ve AD'nin önemli bir biyobelirteç olabilir?
AB42 peptit

IRS-1 proteinini tespit etmek için bir kan tahlili geliştirilmiş ve incelenmiştir. Çalışmalar, AD'li bireylerin, IRS-1 proteininin aktif olmayan formunun daha düşük kan seviyelerine sahip olabileceğini göstermiştir.
YANLIŞ

AD'nin biyobelirteçlerini ölçmek için BOS kullanımının sınırlamaları nelerdir?
*BOS, bir numune elde etmek için invaziv bir spinal musluğun yapılmasını gerektirir.
*BOS toplama ile ilişkili yüksek maliyet vardır.

Quest Diagnostic'in AB42/40 oranını ve APOE izoformu Panel testini tanımlarken aşağıdakilerden hangisi doğru ifadelerdir?
*Test, biyobelirteçleri ölçmek ve tanımlamak için LC/MS/MS kullanır.
*Test, AB42 ve AB40 peptitlerini ölçer ve sonuçları AB42/AB40 oranı olarak ifade eder.
*Test toplam APOE ve çeşitli APOE izoformlarını ölçer

LabCorp'un APOE Alzheimer Risk Testini kullanmanın bir sınırlaması, APOE e4 izoformunun varlığının geç başlangıçlı AD riskini artırmasıdır, ancak e4 izoformu olan birçok hastada AD gelişmez ve geç başlangıçlı AD olanlarda 30- %50'si izoform için negatiftir.
NS

Athena Diagnostic'in ADmark Alzheimer Değerlendirme testi hangi AD biyobelirteçlerini ölçer?
AB42APOE izoformları
Toplam Tau
Fosfo-Tau

AD'nin değerlendirilmesi için biyobelirteç testleri hakkında ne gibi sonuçlar çıkarılabilir?
*Şu anda AD'nin kesin teşhisini yapmak için belirli bir biyobelirteç veya biyobelirteç paneli kullanılmamaktadır.
*Araştırma çalışmaları için, potansiyel tedavilerin erken tespiti, önlenmesi ve etkileri için AD biyobelirteçleri kullanılır.
*Klinik uygulamada, AD için BOS biyobelirteçleri esas olarak doğruluğu artırmak için tanıya yardımcı olmak için kullanılır.

Hangi ifade, AD biyobelirteçlerinin kullanımı için profesyonel toplum ve sigortacı tavsiyelerini doğru bir şekilde tanımlar?
AD biyobelirteçlerinin kullanımı için gerçek onayların veya önerilerin gerisinde kalıyorlar.

AD tedavisi ile ilgili olarak hangi ifadeler doğrudur?
*Şu anda tedavi, zihinsel işlevlerin sürdürülmesine ve AD'nin davranışsal semptomlarının yönetimi ve kontrolüne odaklanmaktadır.
*İlaçlar hastalığı durdurmaz ancak bir süreliğine çeşitli semptomları yavaşlatabilir.
* Herhangi bir ilacın AD tedavisinde başarılı olması olası değildir.

Mevcut AD ilaçlarının türlerinden biri Kolinesteraz İnhibitörleridir. Bu ilaçlar, orta ila şiddetli AD ile ilişkili semptomların ilerlemesini yavaşlatır. Beyindeki aşırı glutamatın toksik etkilerini bloke ederek çalışırlar.
YANLIŞ

Alzheimer Hastalığını (AH) tanımlayan ifadelerden hangisi doğru DEĞİLDİR?
AD, yaşlılarda demansın ikinci en yaygın şeklidir.

Araştırmalar, iki temel proteinin (plaklar ve düğümler) AD'ye neden olmada rol oynayabileceğini göstermiştir. Beyinde plaklar oluşturabilen artık bir parça hangi proteindir?
beta-amiloid

Şu anda AD'yi teşhis etmek için kullanılabilecek tek bir kesin tanı testi yoktur. Bunun yerine tanı, tipik olarak, benzer semptomlara neden olabilecek diğer koşulları ekarte etmek için dışlama veya başka testler kullanılarak yapılır.
NS

Besinlerin zayıf metabolize olduğu beyin bölgelerini göstermek için ne tür Pozitron Emisyon Tomografisi (PET) taraması kullanılır?
Florodeoksiglukoz (FDG) PET

Aşağıdaki genetik testlerden hangisi, AD riskini arttırdığına inanılan ancak doğrudan AD'ye neden olmayan bir "risk" genini ve izoformunu tanımlar?
APOE e4 izoformu

BOS'ta ölçülen iki amiloid betanın (AB peptidleri) hangi oranının kullanılması amiloid plak oluşumunun daha iyi değerlendirilmesini sağlayabilir?
AB42/AB40 oranı

AD ve ilgili semptomları olduğundan şüphelenilen bir hasta, Quest Diagnostics Beta-amiloid ve APOE izoform paneli kullanılarak test edildi. Quest paneli, hastadan toplanan BOS üzerinde gerçekleştirildi ve sonuçlar şöyleydi:
APOE e4 izoformunun varlığı
0.15'lik bir AB42/AB40 oranı
1.5'lik bir algoritma risk değerlendirme puanı
**Yüksek AD riski

LabCorp'un APOE Alzheimer Risk Testinde hangi metodoloji veya metodolojilerin kombinasyonu kullanılıyor?
Restriksiyon enzimi sindirimi ve poliakrilamid jel elektroforezi ile PCR.

Athena Diagnostic'in ADmark Alzheimer Değerlendirmesi testi ile, APOE e4 izoformu yerine esas olarak APOE e2 izoformunun varlığı, daha düşük bir AD olasılığını düşündürür.
NS

AD veya ilgili demansın değerlendirilmesi için biyobelirteç testleriyle ilgili olarak hangi sonuçlara varılabilir?
*AH'nin kesin teşhisini yapmak için spesifik bir biyobelirteç veya biyobelirteç paneli kullanılmaz.
Çeşitli biyobelirteçler için ana örnek kaynağı olmaya devam ediyor. CSFCSF biyobelirteçleri, klinik uygulamada esas olarak AD teşhisinin doğruluğunu iyileştirmeye yardımcı olarak kullanılır.

Alzheimer Derneği şu anda klinik uygulamada kullanım için BOS'ta AB42/AB40 oranının kullanılmasını önermektedir.
YANLIŞ

AD'nin mevcut tedavisi hakkında hangi ifade(ler) doğrudur?
*Herhangi bir ilacın veya tedavinin hastalığı tedavi etmede başarılı olması olası değildir.
*AH tedavisinde kullanılan ilaçlar hastalığı durdurmaz ancak çeşitli semptomları yavaşlatabilir.
*Mevcut tedavi, zihinsel işlevlerin sürdürülmesi ve semptomların kontrolü üzerine odaklanmaktadır.


TARTIŞMA

Bu yazıda, tek molekül deneylerinden DNA'daki NNBP enerjilerini türetmek için metodolojiyi genişlettik ve geliştirdik. NN modelinde dairesel simetrinin tanıtılması, NNBP enerjilerinin sayısını ondan sekize düşürmemizi sağlar. Dairesel simetri, on NNBP enerji uzayında stokastik optimizasyon ile ulaşılan minimumun kararlılık analizinin iki boyutlu bir optimal çözüm manifoldunu vurguladığı (28)'de zaten fark edildi. Bu tür 2 katlı yozlaşma, burada kullanılan iki kendi kendine tutarlı NNBP enerji ilişkisi ile aynı fikirdeydi (SI Ek D). Bu tür dejenerasyondan kaçınarak stokastik optimizasyon, sekiz parametre alanında daha hızlı ve daha güvenilir hale gelir. Ayrıca, dubleks erimedeki son etkilerin, uzun DNA saç tokalarının mekanik olarak açılmasıyla doğrudan ölçülebileceğini gösterdik. AT ve CG başlatma faktörü (IF) katkıları arasındaki fark, en çok FDC boyunca maksimumlar ve minimumlar etrafında önemlidir. Analize dairesel simetri ve IF'lerin dahil edilmesi, daha iyi ayarlanmış tuz düzeltme değerlerine ve oligo dizilerinin erime sıcaklıklarının daha doğru bir tahminine yol açmıştır.

Sonuçlarımız, güçlü bir şekilde heterojen veya diziye bağlı olan Mg2+ baz çiftine özgü tuz düzeltme değerlerini bildirmektedir. Bu gerçek, (28)'de Na+'da, ancak daha az ölçüde gözlemlenmiştir ve şimdi Mg 2+ durumunda daha da doğrulanmıştır. (46)'da, istiflemenin (baz eşleşmesinden ziyade) tek değerli koşullarda DNA stabilite parametrelerinin tuz bağımlılığını tam olarak belirlediği gösterilmiştir. Bu, tek değerli tuz düzeltmelerinin yığın tipine (pürin/pürin veya pürin/pirimidin) bağlı olduğu bulunan (28) ile uyumludur. Buna karşılık, magnezyumda, tuza bağlı düzeltmeler ile NNBP GC içeriği arasında, baz istiflemesinden ziyade baz eşleşmesinin tuz bağımlılığını belirlediğini gösteren açık bir korelasyon gözlenir. Bu dizi korelasyonu nicelleştirilmiştir ve Ref.(28)'de (SI Ek F) bildirildiği gibi erime sıcaklığı tahmin verileriyle uyumludur. Bu anlaşma, NNBP tuz düzeltmelerinin yeni keşfedilen heterojen yapısını doğrular.

Bu çalışmanın sonuçlarını (28)'in sonuçlarıyla birleştirerek, artık magnezyum bağlı iyonları arasındaki dalgalanmaların ve korelasyon etkilerinin zayıf olduğu geniş bir sıcaklık ve tuz koşulu aralığında küresel ve tutarlı bir NN modeli için tüm parametrelere sahibiz. Görebildiğimiz kadarıyla, sunduğumuz açılmayan enerji sayıları, yaygın olarak kullanılan UO veri kümesiyle (entalpi ve entropilerin sıcaklık ve tuz bağımlılıklarına ilişkin bazı varsayımlar göz önüne alındığında) tamamen uyumlu görünmektedir. UO veri seti, yüksek sıcaklıklarda termal denatürasyon deneylerinden elde edildiğinden, açma verileri oda sıcaklığında kuvvet yöntemlerinden elde edildiğinden, bu sonuç önemsiz olmaktan uzaktır. Gerçekten de, çok geniş bir şekilde ayrılmış sıcaklık rejimleri üzerinden ölçülen enerji sayılarını eşleştirme görevi kolay değildir. Ayrıca son durum her iki durumda da tamamen farklıdır (ilk durumda katlanmamış rastgele bobin, diğerinde gerilmiş polimer). Bu sonuçlar, toplu ve açma kuvveti deneylerinde termal denatürasyon deneylerinde türetilen termodinamik veri kümelerinin uyumluluğunu göstermekte, böylece nükleik asit termodinamiğinde çok merkezi olan NN modelinin yeni ve bağımsız bir doğrulamasını sağlamaktadır.

Özetle, NNBP serbest enerjilerine yönelik logaritmik tuz düzeltmelerinin karmaşık doğasına rağmen, heterojen NNBP baz çifti tuz düzeltmemiz, hem erime sıcaklığına hem de magnezyum konsantrasyonunun yaklaşık iki katı büyüklüğündeki verileri açmaya matematiksel olarak basit bir uyum şeması sağlar. Doğrusal-logaritmik düzeltmenin iyi performansı ayrıca 10 mM'nin altında Mg2+ korelasyonunun ve bağlı magnezyum iyonları arasındaki dalgalanma etkilerinin GC içeriği ile güçlü bir korelasyon gösterse de zayıf olduğunu gösterir. Tuz düzeltmelerinin heterojen doğası nedeniyle gözlemlenen diziye bağlı etkiler, bu rejimdeki tüm sıkıştırma açma ve erime verilerini açıklamak için yeterlidir. Bu bağlamda, mevcut tüm deneysel verileri <10 mM aralığında yeniden üretme gerekçemiz, farklı NNBP için heterojen tuz düzeltmelerinin varsayılmasına dayanmaktadır; bu, önceki çalışmalarda gözden kaçan ancak deneysel verilerimizle doğrudan desteklenen bir gerçektir. Örneğin, hem yüksek düzeyde kestirimci sıkıca bağlı iyon (TBI) modeli (53, 54) hem de Poisson-Boltzmann teorisi, DNA'yı belirli nükleotid etkilerinin dahil edilmesinin zor olduğu tek tip yüklü bir polielektrolit olarak ele alan ortalama alan yaklaşımlarıdır. Bu bağlamda, heterojen NNBP'ye bağlı tuz düzeltmelerinin deneysel olarak gösterilmesi, şu anda mevcut ortalama alan teorilerinin ötesine geçen nükleik asit elektrostatikleri üzerine yeni yaklaşımlar geliştirmek için yararlı olan ilgili bir sonuçtur.

Gelecekteki çalışmalar, 10 mM'den yüksek magnezyum konsantrasyonlarında açma deneyleri yaparak iyon korelasyon etkilerini dikkate almalıdır. Bu durumda belirlenen enerji sayıları, lineer logaritmik düzeltmenin ötesinde NNBP enerjileri için yeni tuz bağımlılıkları bulmamıza izin verebilir. Bu, nükleik asitlerdeki dalgalanma ve korelasyon iyon etkilerini daha iyi anlamak ve aynı zamanda, homojen tuz düzeltmelerini varsayan ve yorumlanması zor olan kare logaritmik düzeltmeleri içeren ampirik formülleri uygulamaya gerek kalmadan erime sıcaklıklarını doğru bir şekilde tahmin etmek için uygun olacaktır (36). , 45).

Son olarak, çalışmamız Na + ve Mg 2 + iyonları arasındaki rekabet etkilerini ele almamaktadır ve bunları belirlemek için daha ileri deneylere ihtiyaç vardır. Burada bildirdiğimiz ön sonuçlar, 1,6 Na+'nın stabilize edici etkilerinin kabaca tek bir Mg2+'ya eşdeğer olduğunu gösteren Na+ ve Mg2+ durumları arasındaki NNBP enerjilerinin tuz bağımlılığını enterpolasyon yapmamıza izin verir. Diğer çalışmalar ayrıca farklı sıcaklıklarda açma deneyleri yaparak NNBP entalpilerinin ve entropilerinin doğrudan ölçülmesini (35), ısı kapasitesinin DNA'nın erimesi üzerindeki etkilerini (47, 48), baz istifleme ve hidrojen bağının NNBP enerjilerine katkısını dikkate almalıdır. ( 46, 54) ve son olarak, NN modelini geliştirmek için bir sonraki adım olarak, sıkıştırma açma eğrilerinden Sonraki En Yakın Komşu düzeltmelerinin değerlendirilmesi.


Şekil 2

Şekil 2. Enerji transferi (ET) yoluyla dalga boyu kayması. (a) Araya eklenen YOYO-1'den terminal Cy5 alıcılarına enerji transfer yollarının şeması. Bir DBBP sisteminde hem intra (mavi) hem de inter (gri) dupleks yollar mümkündür, oysa fırçasız DNA'da sadece intradupleks ET mümkündür. (b) Fırça ile hareketsizleştirilmiş DNA, solüsyondaki (sağ spektrum) fırçasız DNA'ya kıyasla daha yüksek ET (sol spektrum) gösterir. Kırmızı ve mavi izler, tüm hibritlenmiş DNA zincirlerinde sırasıyla kovalent terminal Cy5 boyalarını içeren veya hariç tutan DBBP'lere karşılık gelir. ET, 510 nm'de (camgöbeği ok) YOYO-1 floresansındaki azalmaya dayalı olarak hesaplanır, bkz. Yöntemler. (c) Farklı uyarma dalga boylarında fırçalı (siyah eğriler) ve fırçasız (kırmızı eğriler) DNA'nın karşılaştırılması. Sol spektrum: 633 nm'de uyarma (C5'in doğrudan uyarılması). Benzer yoğunluklar, Cy5'in fırçada kendiliğinden sönmediğini gösterir. Sağ spektrum: 450 nm'de uyarma (YOYO-1'in uyarılması). Fırçada daha yüksek Cy5 emisyonu, daha yüksek ET verimliliğinden kaynaklanmaktadır.


Soyut

Conspectus

En basit haliyle DNA, nükleik asitler, su ve iyonlardan oluşan bir topluluktur ve DNA'nın yapısı, üç bileşenin hepsinin nispi oranlarına bağlıdır. DNA, bazı antikanser ilaçları tarafından üretilenler de dahil olmak üzere, endojen veya eksojen reaktif türler tarafından kovalent olarak hasar gördüğünde, topluluk, nükleik asit yapısını, termodinamik stabiliteyi ve ilişkili katyonların ve su moleküllerinin kalitatif ve kantitatif düzenlemesini etkileyen lokal değişikliklere uğrar. Neyse ki, düşük DNA hasarı seviyelerinin biyolojik etkileri, çok miktarda kanonik DNA'nın ortasında DNA hasarını verimli bir şekilde tanıyan ve onaran çok sayıda protein tarafından başarılı bir şekilde hafifletilir.

Bu Hesapta, DNA modifikasyonlarının DNA'nın yüksek çözünürlüklü ve dinamik yapısı, DNA stabilitesi ve iyonların ve su alımı üzerindeki etkisini araştırıyoruz ve bu değişikliklerin, işlevi başlangıçta DNA lezyonlarını yerleştirmek olan proteinler tarafından nasıl algılanabileceğini araştırıyoruz. DNA'nın majör ve minör oluklarında yer alan ve gözlemlenen lezyonları içeren nükleobazlar üzerindeki modifikasyonları tartışıyoruz. canlıdaoksitlenmiş bazların yanı sıra farklı ikame edicilerin konumu ve doğasının DNA topluluğunun termodinamiğini ve yapısını nasıl etkilediğini araştırmamıza izin veren bazı sentetik nükleobazlar dahil. DNA alkilasyonu için ana bölge olan pürinler üzerindeki N7 pozisyonunun modifikasyonu ile ana olukta bir katyon bağlanma bölgesinin bozulmasının entalpik olarak kararsızlaştırıcı olduğu gösterilmiştir. Buna göre, ana olukta katyonik bir yükün bağlanması, entalpik olarak dengeleyicidir.

Birleşik yapısal ve termodinamik çalışmalar, farklı DNA lezyonlarının DNA dinamiklerini nasıl etkilediğine ve modifiye bazların çevreleriyle nasıl etkileşime girdiğine dair ayrıntılı bir resim sağlar. Çalışmamız, kanonik DNA ile lezyonlu DNA arasında farklılaşmayı gerektiren ilk aramada kullanılabilecek DNA lezyonlarında "termodinamik bir imza" olduğu hipotezini desteklemektedir. Bir lezyon ile belirli bir enzim için bir substrat olan aynı kökenli lezyon arasındaki ayrım, başka bir termodinamik ve kinetik faktör katmanını içerir.


Illumina, Inc & Anor v TDL Genetics Ltd & Ors

1. İkinci Davacı, başvuru tarihi 16 Ekim 2003 olan 1 524 321 No'lu Avrupa Patentinin (UK) sahibidir. Patentin en az 11 Ocak 2019'dan beri lisans sahibidir. Roche şirketler grubunun bir üyesi olan Üçüncü Davalı ( Ariosa ), Harmony Testi adı verilen invaziv olmayan bir doğum öncesi testi ( NIPT ) geliştirmiştir. Birinci Sanık ( TDL ) Uyum Testini hastalara sunar ve kullanır. Davacılar, TDL'nin bu şekilde Patenti ihlal ettiğini iddia etmektedir. Ariosa, TDL'nin herhangi bir ihlalinden müştereken sorumlu olduğunu kabul eder. Davalılar, Harmony Testinin Patenti ihlal ettiğine ve Ikeda ve arkadaşlarına göre aşikar olduğu gerekçesiyle Patentin iptali için karşı dava açtığına itiraz ediyor , Fetal DNA'nın maternal plazmada bulunma sıklığı: Parça uzunluğuna göre fark , J Japan Soc of Obs & Gyn , 55(2), P-910 (2003) ( Ikeda ) ve yetersizlik. Davalılar tarafından gündeme getirilen bir dizi başka konu, kapanış sunumlarında takip edilmemiştir.

2. Her iki taraf da iki teknik uzman çağırdı, ancak iki uzman çifti eşleşmedi. Ayrıca, her iki taraf da Ikeda'nın çevirisiyle ilgili bir konuyu ele almak için bir Japonca uzmanı çağırdı.

Davacıların teknik uzmanları

3. 2015'ten beri Profesör William Allen Hogge, Virginia Commonwealth Üniversitesi'nde Kadın Hastalıkları ve Doğum Bölümü'nde Profesör olarak görev yapmaktadır. 1970 yılında Virginia Üniversitesi'nden Biyoloji alanında lisans derecesini ve 1973 yılında aynı kurumdan MD derecesini aldı. Virginia Üniversitesi Hastanesi'nde Kadın Hastalıkları ve Doğum Uzmanlığı ve özel muayenehanede bir büyü yaptıktan sonra, bir dizi Asistan ve Doçentlik yaptı. 1982'den 1992'ye kadar doğum ve jinekoloji bölümlerinde profesör pozisyonları. 1992'den 2014'e kadar Pittsburgh Üniversitesi ( UP ) Tıp Fakültesi'nde Kadın Hastalıkları ve Doğum Anabilim Dalı'nda Profesör olarak görev yaptı. 1992'den itibaren aynı zamanda UP'de İnsan Genetiği Doçenti ve Üreme Genetiği Direktörü ve Pittsburgh'daki Magee-Kadın Hastanesinde (MWH) Genetik Bölümü Tıbbi Direktörü olarak görev yaptı. 1997'den 2013'e kadar MWH'de Gebelik Tarama Laboratuvarı Direktörü olarak görev yaptı. 2003-2014 yılları arasında UP Tıbbi Genetik ve Genomik Merkezi'nin Direktörü ve UP Tıp Fakültesi'nde Kadın Hastalıkları ve Üreme Bilimleri Anabilim Dalı Başkanı olarak görev yaptı. 2010'dan 2014'e kadar UP Tıp Fakültesi'nde Patoloji Anabilim Dalı'nda Profesör olarak görev yaptı. Klinik çalışması, amniyosentez ve CVS gibi doğum öncesi tanı prosedürlerinin yürütülmesini içermiştir ve invaziv olmayan doğum öncesi tanı yöntemleriyle ilgili araştırmalara dahil olmuştur. Prenatal tanı ile ilgili 19 kitap ve 80'den fazla bilimsel yayının yazarı veya ortak yazarıdır.

4. Sanıkların avukatı, Prof Hogge'un ölçülü bir şekilde ifade verdiğini kabul etti ve onu eleştirmedi. Avukat, Prof Hogge'un ilgili kişisel deneyiminin Davalıların uzmanlarından daha sınırlı olduğunu ileri sürdü, ancak Prof Hogge'un dosyalama tarihinde hücresiz DNA alanının durumundan haberdar olduğunu ve bunu düşündüğünü kabul etti.

5. Profesör Michael Lovett, 2013'ten beri Londra'daki Imperial College'daki Ulusal Kalp ve Akciğer Enstitüsü'nde Sistem Biyolojisi Profesörü olarak görev yapmaktadır. 1977'de Edinburgh Üniversitesi'nden Moleküler Biyoloji alanında lisans ve 1981'de Imperial'den Biyokimya alanında doktora derecesi aldı. 1982'den 1987'ye kadar önce Doktora Sonrası Araştırma Görevlisi ve ardından San Francisco California Üniversitesi'nde Genetik alanında Yardımcı Doçent oldu. 1987'den 1992'ye kadar Genelabs Inc.'de çalıştı. 1992'den 1999'a kadar Texas Southwestern Tıp Merkezi Üniversitesi'nde Biyokimya Doçenti olarak görev yaptı. 1999'dan 2013'e kadar dünyanın beş ana Genom merkezinden biri olan St Louis'deki Washington Üniversitesi Tıp Fakültesi'nde Genetik ve İnsan Genetiği Bölüm Başkanı olarak görev yaptı. 2003 yılında, ilgili genlerin hedeflenen yakalanmasını ve dizilenmesini ve Mendel bozukluklarında mutasyonların keşfedilmesini sağlayan, genomik materyalin tanımlanmış bölgelerinin doğrudan seçimine yönelik yöntemler üzerinde çalışmalar yürütüyordu. Profesör Lovett, memeli moleküler genetiği ve genomiği ile ilgili 100'den fazla bilimsel yayının yazarı veya ortak yazarıdır.

6. Sanıkların Avukatı Prof Lovett'ı tanık olarak eleştirmedi, ancak Prof Lovett'ın geçmişinin gen ekspresyonunda olduğunu ve (Dr Daniels'ın aksine) Prof Lovett'in başvuru tarihinde olmadığını ve hiçbir zaman sahip olmadığını takdir etmenin önemli olduğunu belirtti. hücre içermeyen DNA alanında olmuştur. Bunun benim için dikkate alınması gereken bir faktör olduğunu kabul ediyorum, ancak öte yandan Prof Lovett'ın, bu alanda uzman olan kişinin Ikeda'yı nasıl anlayacağı konusunda Mahkemeye yardımcı olacak bir konumda olmadığı öne sürülmedi.

Davalı teknik uzmanlar

7. Ekim 2015'te emekli olmadan önce, Dr Geoff Daniels, Bristol'deki Uluslararası Kan Grubu Referans Laboratuvarı'nda (IBGRL) Teşhis Başkanı ve Bristol Transfüzyon Bilimleri Enstitüsü'nde (BITS) Kıdemli Araştırma Görevlisi olarak görev yapmıştır. 1972'de Aberdeen Üniversitesi'nden Zooloji alanında lisans ve 1980'de Londra Üniversitesi'nden doktora derecesi aldı. 1972'den 1973'e kadar Güney Londra Transfüzyon Merkezi'nde çalıştı. 1973-1995 yılları arasında Tıbbi Araştırma Konseyi Kan Grubu Birimi'nde çalıştı. 1995'ten 2015'e kadar IBGRL'de çalıştı, 2001'de Moleküler Teşhis Başkanı, 2012'de Teşhis Başkanı ve BITS'de çalıştı. 1988'den 2015'e kadar Bristol Üniversitesi'nde öğretim sorumlulukları da vardı. 2001'den itibaren zamanının yaklaşık yarısı bir kan grubu fenotipleme servisini yönetmekle (yaklaşık yarısı anne plazması kullanılarak kan grubu antijenlerinin invaziv olmayan doğum öncesi testini içeriyordu) ve yarısı da küçük bir araştırma ekibini yönetmek ve öğretmekle geçirdi. 2001'de Lo 1998'e dayalı kantitatif PCR kullanarak maternal plazmada fetal hücresiz DNA üzerinde RhD için non-invaziv prenatal test için bir hizmetin kurulmasında işbirliği yaptı (bununla ilgili olarak aşağıya bakınız). 2003'te IBGRL tarafından doğum öncesi testler için alınan örneklerin çoğu RhD içindi, ancak bazıları Y-kromozom belirteçlerini test etmek içindi. Dr Daniels, hem kan grupları hem de kariyeri boyunca 200'den fazla bilimsel makale yayınlanmış bir kitabın yazarı ve başka bir kitabın ortak yazarıdır.

8. Davacıların Avukatı, Dr Daniels'ın sözlü kanıtını çok adil bir şekilde verdiğini kabul etti. Avukat, Dr Daniels'ın Ikeda hakkındaki kanıtlarının, dosyalama tarihinde sahip olduğu kişisel bilgiler ve geçmiş görüşlerle lekelendiğini, bağlam içinde dikkate alınmasının uygun olduğunu, ancak bunun Dr Daniels'ın kişisel bir eleştirisi olmadığını açıkça belirtti.

9. 2008'den beri Profesör Alain Thierry, Institut de Recherche en Canc rologie de Montpellier'de INSERM'de Araştırma Direktörü olarak görev yapmaktadır. 1981'de Universit de Clermont'tan Biyolojik Bilimler ve Teknoloji alanında lisans, 1983'te Universit de Clermont-Ferrand II'den yüksek lisans ve 1986'da Universit Montpellier 2'den doktora derecesi aldı. 1986'dan 1992'ye kadar Universit de'de doktora sonrası pozisyonlarda bulundu. Clermont-Ferrand II ve Lombardi Kanser Merkezi, Georgetown Üniversitesi Tıp Merkezi'nde çalıştı ve 1992'den 1996'ya kadar ikinci kurumda Yardımcı Doçent oldu. 1997'den 2001'e kadar Biovector Therapeutics'te Gen Terapisi ve Teslimat Bölümünde Bilimsel Direktörlük yaptı. 2001'den 2007'ye kadar Montpellier 2 Üniversitesi'nde Doçent olarak görev yaptı ve burada gen dağıtımı ve gen terapisi ve DNA komplekslerinin biyofiziği üzerinde çalıştı. 2005 yılından bu yana araştırmaları, dolaşımdaki hücresiz DNA'nın boyutu, yapısı ve kökenleri ile özellikle onkoloji alanında dolaşımdaki hücresiz DNA'yı saptamak için yöntemlerin uygulanmasına odaklanmıştır. Dolaşımdaki hücresiz DNA ile ilgili 20'den fazla hakemli yayının yazarıdır.

10. Davalılar, yetersizlik davalarını desteklemek için esas olarak Prof Thierry'nin kanıtlarına dayanmışlardır. Davacıların avukatı, Prof Thierry'nin bir görev adamı olduğunu ileri sürdü. Avukat, Prof Thierry'nin gayretinin tamamen gerçek olduğunu kabul etti, ancak Mahkeme'nin sorusunun, görüşlerinin mevcut verilerle desteklenip desteklenmediği olduğunu ileri sürdü. Buna katılıyorum.

11. Davacılar uzmanı Profesör Peter Kornicki'dir. Ana dili İngilizce olan Prof Kornicki, 2014'ten beri Cambridge Üniversitesi'nde Japon Çalışmaları alanında Emeritus Profesörü olarak görev yapmaktadır. 1972'de Oxford Üniversitesi'nden Japonca ve Korece lisans derecesi, ardından 1975'te Yüksek Lisans ve Japonca DPhil derecesi almıştır. 1979'da edebiyat. 1978'den 1982'ye kadar Tazmanya Üniversitesi'nde ve 1982'den 1985'e kadar Kyoto Üniversitesi'nde ders verdi. 1985 ve 2014 yılları arasında Cambridge'de sırasıyla öğretim görevlisi, Japon Tarihi ve Bibliyografyası okuyucusu, Japon Çalışmaları Profesörü ve Doğu Asya Çalışmaları Profesörü oldu.Diğer onurların yanı sıra, İngiliz Akademisi Üyesi seçildi, Oxford Üniversitesi tarafından Edebiyat Doktoru derecesi ve Japonya İmparatoru tarafından Altın Işınları ve Boyun Kurdelesi ile Yükselen Güneş Nişanı ile ödüllendirildi. Japon kültürü ve özellikle Japon kitapları hakkında çok sayıda kitap ve makale yayınladı.

12. Sanıklar uzmanı Profesör Yoshifumi Itoh'du. Ana dili Japonca olan Prof Itoh, 2001'den beri Kennedy Romatoloji Enstitüsü'nde, başlangıçta Londra'daki Imperial College'da ve 2011'den beri Oxford Üniversitesi'nde Kıdemli Öğretim Görevlisi olarak görev yapmaktadır. Prof Itoh, Japonya'da eğitim gördü ve ikinci dil olarak İngilizce okudu. 1989 yılında Tokyo Eczacılık Koleji'nden Eczacılık alanında lisans, 1991 yılında aynı kurumdan Klinik Eczacılık (Biyokimya) alanında yüksek lisans ve 1996 yılında aynı kurumdan Doktora derecesi almıştır. 1991'den 1997'ye kadar önce Araştırma Görevlisi ve Daha sonra Kansas Üniversitesi Tıp Merkezi'nde Doktora Sonrası Araştırma Görevlisi olarak. 1997'den 2001'e kadar Tokyo Üniversitesi Tıp Bilimleri Enstitüsü Kanser Araştırmaları Bölümü'nde Yardımcı Doçent olarak görev yaptı. Kariyeri boyunca, Prof Itoh, hem Japonca hem de İngilizce olarak yoğun bir şekilde çalıştı ve her iki dilde de birçok bilimsel makale yazıp gözden geçirdi.

13. Hem Prof Kornicki hem de Prof Itoh'un Mahkemeye yardımcı olmak için ellerinden gelenin en iyisini yaptıkları ortak bir zemindir. Davacıların Avukatı, Prof Kornicki'nin (diğer şeylerin yanı sıra) bir Japon dilbilimci olarak uzmanlığı olduğu için, Prof Kornicki'nin bunu yapmak için daha iyi bir konumda olduğunu, buna karşın Prof Itoh'un bir dilbilimci olmadığını ileri sürdü. Ayrıca, Prof Kornicki ana dili İngilizcedir ve çevirmenlerin ana dillerine çeviri yapması gerektiği genel olarak kabul edilir. Sanıkların Avukatı, Prof Itoh'un, bilimsel özetlerin hem Japonca hem de İngilizce olarak nasıl yazıldığını bilen anadili Japonca olduğu için Mahkemeye yardımcı olmak için daha iyi bir konumda olduğunu ileri sürdü. Benim görüşüme göre, her iki açıdan da kanıta sahip olmak yardımcı oldu.

14. Teknik arka planın aşağıdaki açıklaması, esas olarak, taraflarca yararlı bir şekilde kararlaştırılan primere dayanmaktadır.

15. İnsan genomu, bir insan hücresindeki deoksiribonükleik asitte (DNA) kodlanmış kalıtsal talimatların tamamını temsil eder. İnsan haploid genomu (yani bir kromozom seti) yaklaşık 3 milyar baz DNA çiftinden oluşur. Tipik diploid bireylerde (yani, dengeli bir kromozom çiftine sahip bireyler) genom, toplam 46 kromozom halinde düzenlenir.

16. Kromozomlar, DNA ve protein komplekslerinden oluşur. Kromozomal DNA, bir çift sarmal oluşturmak üzere sarılmış iki tamamlayıcı iplikten oluşur. DNA çift sarmalı, nükleozom adı verilen kompleksler oluşturmak için histon proteinlerinin etrafına sıkıca sarılır. Nükleozomlar, bir kromozomun kromatidini oluşturmak üzere kıvrılan kromatin liflerini oluşturmak üzere katlanır. Bir kromozomun yapısal organizasyonu aşağıdaki Şekil 1'de gösterilmektedir. Transkripsiyon ve replikasyon gibi işlemler sırasında, transkripsiyon veya replikasyonun ilerlemesine izin vermek için kromatin lifleri açılır ve/veya histonlar geçici olarak çıkarılır.

17. DNA şeritleri, fosforile şeker (deoksiriboz) omurgasından oluşan nükleotidlerden oluşur ve her şeker birimi azotlu bir baza bağlıdır. DNA'da dört farklı azotlu baz vardır: adenin (A), sitozin (C), guanin (G) veya timin (T). İki tamamlayıcı iplik, (diğer etkileşimler arasında) baz eşleşmesi ve bazlar arasında hidrojen bağlarının oluşmasıyla bir arada tutulur; burada genel kural, sitozin (C)'nin yalnızca guanin (G) ve adenin (A) ile yalnızca çiftler olmasıdır. timin (T) ile. Sitozin (C), guanin (G) ile üç hidrojen bağı ile eşleşirken, adenin (A) timin (T) ile iki hidrojen bağı ile eşleşir.

18. Kromozomal DNA, insan hücre çekirdeğinde kopyalanır. Yukarıda açıklandığı gibi, bunun meydana gelmesi için DNA-protein komplekslerinin demonte edilmesi ve DNA ipliklerinin replike olan DNA bölgesinde geçici olarak ayrılması gerekir. DNA helikazları, tamamlayıcı zincirlerin önceden bağlanmış başlatıcı proteinlerin bölgesinden enzime bağımlı ayrılmasını katalize ederek, DNA polimeraz enzim aktivitesinin serbest deoksinükleosit trifosfatlar (dNTP'ler) kullanarak iki yeni zincir sentezlemesine izin verir. Büyüyen DNA zincirine her deoksinükleotidin dahil edilmesiyle, bir pirofosfat (birbirine bağlı iki fosfat grubu) salınır. Orijinal DNA molekülünün her bir zinciri, orijinal DNA molekülünün iki kopyasını oluşturmak için tamamlayıcı bir zincirin üretimi için bir şablon görevi görür. DNA replikasyonunun şematik bir temsili aşağıdaki Şekil 3'te gösterilmektedir.

19. Genler, belirli proteinleri ve kodlamayan RNA'ları kodlayan genomdaki fonksiyonel DNA birimleridir. Protein kodlayan genler, haberci ribonükleik asit (mRNA) üretmek için kopyalanabilir, bu da gen tarafından kodlanan proteini üretmek üzere çevrilebilir.

20. Normal bir insan somatik hücresindeki (gamet dışındaki hücreler (spermatozoa ve ova (yumurta hücreleri)), germ hücreleri (gametleri oluşturan hücreler), gametositler ve farklılaşmamış kök hücrelerdeki 46 kromozom 22 çiftten oluşur. homolog otozomlar (cinsiyet dışı kromozomlar) ve iki allozom (tipik dişiler için cinsiyet kromozomları XX ve tipik erkekler için XY). 23 kromozomdan oluşan bir set anneden, 23 kromozomdan oluşan bir set ise babadan kalıtılır. Otozomların (ve tipik XX dişileri durumunda X kromozomlarının) diploid (veya eşleştirilmiş) olduğu söylenir.

21. Her kromozom bir dizi gen taşır. Normal somatik hücrelerde, otozomal genler çiftler halinde bulunur; bir gen anneden, diğeri babadan kalıtılır. Her gen, bir kromozom üzerindeki belirli bir bölgede veya lokusta kodlanır. Bir genin farklı versiyonları (örneğin, tek veya çoklu baz değişiklikleri gibi varyantların neden olduğu) aleller olarak adlandırılabilir. Bir bireyin aynı alelin iki kopyasına sahip olduğu durumlarda (yani, bir çift içindeki her bir kromozom üzerindeki belirli bir lokusta aynı alel), alellerin farklı olduğu (yani, farklı aleller bulunduğu) alele göre homozigot oldukları söylenir. bir çift içindeki her kromozom üzerindeki belirli bir lokus), bireyin o alele göre heterozigot olduğu söylenir. Bir bireyin tipik iki aleli yerine yalnızca bir alele sahip olduğunda hemizigot olduğu söylenir (örneğin, bir çiftin yalnızca bir kromozomunun mevcut olduğu, bir alelin bir kopyasının silindiği veya normal durumda olduğu durumlarda ortaya çıkabilir). erkek somatik hücreler, allozomlarda bulunan belirli genler açısından).

22. Normal erkek somatik hücreler, anneden kalıtılan bir X kromozomu ve babadan kalıtılan bir Y kromozomu içerirken, normal dişi somatik hücreler, biri anneden ve biri babadan olmak üzere iki X kromozomu içerir. Normal gametler (spermatozoa ve ova) haploiddir, yani her kromozomun yalnızca bir kopyasını içerirler. Normal yumurta bir X allosome taşır. Spermatozoaların yaklaşık %50'si bir X allosome içerir ve %50'si bir Y allosome içerir.

23. Tipik olarak, annenin allosome genotipi XX'dir, bu nedenle çocuğuna bir X kromozomu geçirir ve babanın allosome genotipi XY'dir, bu nedenle ya bir X kromozomunu yavrularına geçirir (XX genotipli bir kız çocuğu ile sonuçlanır), veya bir Y kromozomu (XY genotipli bir erkek çocukla sonuçlanır). Bununla birlikte, anöploidiler dahil olmak üzere allozomları içeren bir dizi bilinen anormal genetik durum vardır.

24. Bir lokusta farklı varyantların varlığına genetik polimorfizm denir. Bir polimorfik lokusta belirli bir varyantın varlığı, bir işaretleyici olarak işlev görebilir. Bazı varyantlar farklı biyolojik fenotiplere yol açarken (yani, göz rengi veya kan grubu gibi bireylerin gözlemlenebilir özellikleri veya özellikleri), diğerlerinin fenotipik etkisi yoktur veya bilinmemektedir.

25. Tek baz değişiklikleri veya çoklu baz değişiklikleri yoluyla farklı aleller ortaya çıkabilir. Bir popülasyonda en azından belirli bir prevalansla meydana gelen tek baz değişiklikleri, artık tek nükleotid polimorfizmleri veya SNP'ler olarak bilinmektedir. Genotipleme, bir bireyin DNA'sı ile genel popülasyon veya diğer belirli bireyler arasındaki farklılıkların belirlenmesi anlamına gelir.

26. Genetik bozukluklara genomdaki patojenik değişiklikler neden olabilir. Genetik bozukluklar, tek bir genin değiştirildiği Mendel (veya tek gen) bozukluklarını veya kromozomun tamamının veya büyük bir bölümünün silindiği, kopyalandığı, yer değiştirdiği veya başka bir şekilde değiştirildiği kromozomal bozuklukları içerir.

27. Genetik bozukluklar kalıtsal olabilir veya ilk kez yumurta, spermatozoa veya döllenmiş yumurtada ortaya çıkabilir (de novo olarak adlandırılır) veya bir kişinin yaşamı boyunca ortaya çıkabilir (edinilmiş olarak adlandırılır).

28. Mendel bozuklukları (tek gen bozuklukları olarak da bilinir), tek bir gendeki mutasyonun neden olduğu genetik bozukluklardır. Otozomal resesif tek gen bozuklukları, bir genin her iki allelinde de mutasyon bulunan bireylerde (yani mutasyon için homozigot olan bireylerde) ortaya çıkar. Mutant allelin tek bir kopyasına sahip olan bir birey (yani mutasyon için heterozigot olan bireyler), bozukluğun taşıyıcısı olarak adlandırılır. Otozomal resesif tek gen bozukluklarının örnekleri arasında kistik fibroz ve hemoglobinopatiler yer alır. Otozomal dominant tek gen bozuklukları, mutant allelin yalnızca tek bir kopyasını gerektirir ve bu nedenle hem heterozigot hem de homozigot bireylerde ortaya çıkar. Otozomal dominant tek gen bozukluklarının örnekleri arasında Huntington koresi ve Marfan sendromu bulunur.

X kromozomuna bağlı resesif bozukluklar

29. X kromozomuna bağlı çekinik bozukluklar, X kromozomundaki bir mutasyona bağlı olarak ortaya çıkan genetik bozukluklardır. X kromozomuna bağlı resesif bozukluklar, gen mutasyonu için hemizigot olan erkeklerde (çünkü erkekler tek bir X kromozomuna sahip olduğundan) veya gen mutasyonu için homozigot olan kadınlarda (yani X kromozomlarının her iki kopyası da mutasyona sahiptir) ortaya çıkar. Bununla birlikte, kısmen mutasyonun tek bir kopyasını kalıtım yoluyla alma olasılığının iki kopyayı kalıtsal olarak almaktan daha yüksek olması nedeniyle, X kromozomuna bağlı resesif bozukluklardan etkilenenler tipik olarak erkeklerdir. X kromozomuna bağlı çekinik bozuklukların örnekleri arasında hemofili, Duchenne kas distrofisi ve frajil X sendromu bulunur.

30. Olağan tamamlayıcıdan (yani 46 kromozom) kromozom sayısında bir varyasyonun varlığı, anöploidi olarak adlandırılır. Normal bir çiftten tek bir kromozomun olmamasına monozomi, tek bir kromozomun normal bir çifte ek bir kopyasının bulunmasına ise trizomi denir. Ek kromozom tek başına olabilir veya başka bir kromozoma bağlı olabilir. Ek kromozom babadan veya anneden kalıtsal olabilir. En yaygın anöploidi formu (21. kromozomun trizomisi) Down sendromu ile sonuçlanır.

31. Tam kan, kan hücreleri ve sıvı bir kısım içerir. Kan hücreleri arasında oksijen taşıyan eritrositler (kırmızı kan hücreleri), lökositler veya beyaz kan hücreleri olarak adlandırılan bağışıklık hücreleri ve kanın pıhtılaşmasını düzenleyen trombositler (trombosit) bulunur. Olgun eritrositler çekirdeksizdir, yani bir çekirdek veya kromozomal DNA içermezler. Olgunlaşmamış çekirdekli kırmızı kan hücreleri de fetüslerin kanında bulunur, ancak doğumdan sonra kan dolaşımından hızla temizlenir.

32. Kanın sıvı kısmı, kan numunesi bir antikoagülan ile tedavi edildiğinde plazma olarak veya kanın pıhtılaşmasına izin verildiğinde serum olarak elde edilebilir. Plazma, su, kan plazma proteinleri (pıhtılaşma faktörleri dahil), hücresiz DNA ve minerallerin yanı sıra çözünmüş besinler (glikoz, amino asitler ve yağ asitleri gibi) ve atık ürünler (örneğin, üre ve laktik asit).

33. Tam kan, genel olarak ve deneysel koşullara bağlı olarak, santrifüjleme ile (aşağıda daha ayrıntılı olarak anlatılmaktadır) ayrılabilir: (i) üst plazma tabakası (ii) ara buffy lökositleri ve trombositleri içeren kaplama tabakası ve (iii) eritrositleri içeren alt tabaka. Kromozomal DNA, çekirdekli hücreler içeren buffy coat tabakasından ve hücresiz DNA içeren plazma tabakasından ekstrakte edilebilir.

34. DNA dahil olmak üzere hücre içermeyen nükleik asit fragmanları, insan kan plazmasında ve serumunda bulunur. Hücresiz nükleik asitler, hücre ölümü dahil olmak üzere çeşitli kaynaklardan kaynaklanabilir.

35. Nekroz, enfeksiyon, toksinler veya travma nedeniyle ortaya çıkan bir hücre ölümü mekanizmasıdır. Nekroz, hücre zarının bütünlüğünün kaybını ve hücre ölümü ürünlerinin kontrolsüz salınımını içerir.

36. Apoptoz (veya programlanmış hücre ölümü), bir dizi sinyal yolu aracılığıyla başlatılabilen, yüksek düzeyde düzenlenmiş bir hücre ölümü sürecidir. Apoptoz, aşağıdakileri içeren karakteristik hücre morfolojisi ile karakterize edilir: (i) kabarma (hücre zarında kabarcıklar olarak bilinen çıkıntıların oluşumu) (ii) hücre küçülmesi (iii) nükleer yoğunlaşma (piknoz) ve parçalanma (karyoreksis) (iv) kromatin yoğunlaşması ve (v) kromozomal DNA fragmantasyonu.

37. Fallop tüplerinde bir sperm tarafından bir yumurtanın (yumurta) döllenmesinden sonra, oluşan tek hücreli zigot Fallop tüpünden aşağı doğru ilerler ve bir blastosist oluşturmak üzere bölünür. Döllenmeden yaklaşık beş gün sonra, trofoblast hücreleri ve embriyonik hücrelerden oluşan blastosist rahme ulaşır ve rahmin endometriyumuna (duvar tabakasına) gömülür.

38. Embriyonik hücreleri çevreleyen trofoblast hücreleri çoğalır ve uterus astarına daha fazla yerleşir ve sonunda plasentayı oluşturur (aşağıda açıklanmıştır). Blastosist, döllenmeden yaklaşık 7-12 gün sonra tamamen implante olur.

39. İkinci haftanın başında sıvı dolu amniyotik kese oluşumu başlar. Fetal gelişim, fetüsü yastıklayan ve yüzdürme sağlayan amniyotik kesede gerçekleşir.

40. Plasenta, anne dokularının yanı sıra fetüsten türetilen dokulardan oluşan birleşik bir yapıdır. Fetal kan damarları göbek kordonu yoluyla plasentaya uzanır ve birçok koryonik villusa dallanır, plasenta zarı adı verilen bir doku tabakası boyunca fetal ve maternal kan arasındaki materyal değişimi için geniş bir yüzey alanı sağlar. Besinler ve oksijen de dahil olmak üzere çeşitli materyaller, plasentadaki koryonik villus ve göbek kordonu yoluyla maternal dolaşım sistemi ile fetüs arasında değiştirilir. Fetüs veya plasentadan anne kan dolaşımına geçen diğer materyaller, Rh hastalığı testinin temelini oluşturan fetal kan hücreleri, proteinler ve hormonları içerir. Aynı şekilde atık maddeler de fetüsten anne dolaşımına taşınır.

Rhesus hemolitik hastalığı

41. Rhesus (Rh) faktörü (Rh D antijeni olarak da bilinir), Rh pozitif olarak adlandırılan kişilerde kırmızı kan hücrelerinin yüzeyinde bulunan bir proteindir. Rh negatif bireyler bu proteinden yoksundur. Rh negatif bireylerde bu proteinin eksikliği, onu kromozom 1'in her iki kopyasında kodlayan genin (RhD) delesyonu veya mutasyonlarından kaynaklanır. Rh faktörü ve Rh pozitif olarak kabul edilir.

42. Rh hastalığı, fetüsün hemolitik hastalığına neden olabilir, bu da ciddi vakalarda anemiden ölü doğumla sonuçlanabilir. Bu sorun tipik olarak ikinci veya sonraki gebeliklerde Rh negatif bir annenin Rh pozitif bir fetüs taşıdığı durumlarda ortaya çıkar. Başka bir deyişle, çocuk, RhD geninin silindiği veya mutasyona uğradığı kromozom 1'in bir kopyasını annesinden ve RhD geninin bulunduğu babadan kromozom 1'in bir kopyasını miras alır. Çocuk, RhD geninin işlevsel bir kopyasına sahip olduğundan, çocuk Rh faktörü üretir ve bu nedenle Rh pozitif olarak adlandırılır.

43. Rh negatif bir anne Rh pozitif bir fetüs taşıdığında, fetüs kırmızı kan hücrelerinde Rh faktörünü ifade eder. Hamilelik ve doğum sırasında anne, Rh faktörünü eksprese eden fetal kırmızı kan hücrelerine maruz kalabilir. Anne, yabancı olarak tanımladığı Rh faktörüne karşı bir bağışıklık tepkisi oluşturur ve böylece bağışıklık sistemi Rh faktörüne karşı duyarlı hale gelir. Rh faktörüne duyarlı bir Rh negatif anne, sonraki gebeliklerde Rh pozitif bir fetüsün kırmızı kan hücrelerini yok eden bir bağışıklık tepkisi oluşturabilir.

44. Fetüsün Rh durumunu belirlemek için non-invaziv bir test kullanılarak ve Rh pozitif fetüs taşıyan tüm Rh negatif annelere hamilelik sırasında ve/veya doğumdan hemen sonra anti-Rh faktör antikorları (buna profilaktik anti-D), herhangi bir Rh pozitif fetal kırmızı kan hücresinin, annenin bağışıklık sistemi tarafından onlara karşı bir bağışıklık tepkisi oluşturulmadan önce maskelenmesini sağlayarak, sonraki Rh pozitif gebeliklerle ilgili sorunları önler.

Fetal hücrelerin sitogenetik analizi

45. Sitogenetik teknikler, kromozomların sayısını ve yapısını analiz eder. Fetal hücrelerde kromozomların görselleştirilmesiyle trizomiler gibi kromozomal anormalliklerin tanımlanmasına izin veren karyotipleme ve floresan in situ hibridizasyon (FISH) gibi teknikleri içerir. Bir bireyin karyotipi, hücrelerinin çekirdeğindeki kromozomların sayısı ve görünümüdür.

46. ​​Karyotipleme, ışık mikroskobu altında görülmelerini sağlamak için kromozomların bir boya ile boyanmasını içerir. Bireysel kromozomlar uzunlukları, sentromerin konumu (kromozomun iki kolun birleştiği kısmı) ve kromozom kollarındaki bantlama modeli ile tanımlanabilir. Bu nedenle karyotipleme, ek kromozomların varlığı nedeniyle otozomal trizomiler gibi kromozomal anormalliklerin tanımlanmasına izin verir. Karyotipleme, kromozomların büyük bölümlerinin (genellikle 2 Mb'den büyük) kaybından veya yer değiştirmesinden kaynaklanan bozuklukları tanımlamak için de kullanılabilir.

47. FISH, ilgilenilen genin bölümünü tamamlamak ve ona bağlanmak üzere tasarlanmış floresan etiketli tek iplikli DNA problarını kullanır. Prob, spesifik kromozomlar üzerindeki tamamlayıcı dizilere bağlanır, böylece ilgili tamamlayıcı dizilerin floresan mikroskobu ile görselleştirilmesine izin verir. Bu nedenle, trizomi 21'in varlığı, kromozom 21'e özgü bir prob kullanılarak tespit edilebilir. Normal (diploid) bir hücrede bulunan ikisi yerine, fetal hücrede üç floresan noktanın varlığı, trizomiyi gösterir. Bu prosedür normalde tekrarlanabilir bir sonuç sağlamak için bir numuneden alınan birkaç hücre üzerinde gerçekleştirilir.

Koryon Villus Örneklemesi

48.Koryonik Villus Örneklemesi (CVS), fetüs ile aynı karyotipe sahip olması muhtemel plasental hücrelerin toplanması için bir yöntemdir. Örnek, plasentanın koryonik villusundan (i) plasentaya ulaşmak için vajina ve serviksten sokulan bir kateter kullanılarak (transservikal CVS) veya (ii) karın içinden sokulan bir iğne kullanılarak toplanır. anne ultrason rehberliğinde (transabdominal CVS) plasentaya alınır. Toplamadan sonra, hücrelerin maternal dokudan değil koryonik villiden olduğundan emin olmak için kontroller yapılır ve daha sonra hücreler kültürlenir ve sitogenetik analize tabi tutulur (yukarıdaki L bölümüne bakınız).

49. CVS tipik olarak hamileliğin ilk üç ayında gerçekleştirilir. CVS'den kaynaklanan gebelik kaybı riski, hastalar için genellikle aralığın üst sınırında, yani yaklaşık %1'dir.

50. Amniyosentez, ultrason rehberliğinde karın ve uterustan amniyotik keseye sokulan bir iğne kullanılarak fetal hücreler içeren amniyotik sıvının alınmasını içerir. Toplandıktan sonra, fetal hücreler kültürlenir ve sitogenetik analize tabi tutulur.

51. Amniyosentez tipik olarak hamileliğin ikinci üç aylık döneminde yapılır. Amniyosentezden kaynaklanan gebelik kaybı riski, hastalar için genellikle aralığın üst sınırında, yaklaşık %1'dir.

Fetal kan ve doku örneklemesi

52. Fetal kan ve doku örneklemesi, fetal kan veya doku örneklerinin toplanmasını içerir. Fetal kan örnekleri, ultrason rehberliğinde göbek kordonuna veya fetüsün intrahepatik damarına sokulan bir iğne kullanılarak alınabilir. Deri, akciğer, karaciğer ve böbrek örnekleri de dahil olmak üzere fetal doku örnekleri, fetoskopik veya ultrasonik kılavuzluk altında fetal biyopsi teknikleri kullanılarak alınabilir.

53. Fetal kan ve doku örneklemesi gebeliğin ikinci trimesterinde yapılabilir, ancak gebelik kaybı riskinin yüksek olması ve tanıların genellikle amniyotik sıvı veya CVS materyali kullanılarak yapılabilmesi nedeniyle pratikte genellikle kaçınılır.

54. 1997'de Profesör Dennis Lo ve meslektaşları, hamile kadınların kan plazması ve serumunun hem maternal hem de fetal hücre içermeyen DNA içerdiğini keşfettiler (Lo ve diğerleri, Fetal DNA'nın maternal plazma ve serumda varlığı , Lancet , 350, 485-87 (1997) Ertesi yıl Prof Lo'nun grubu, fetal hücresiz DNA'nın maternal plazma ve serumda anne kanındaki fetal hücrelerden çok daha yüksek miktarlarda bulunduğunu ve fetal hücresiz DNA'nın yedinci yıl gibi erken bir tarihte tespit edilebileceğini gösterdi. (Lo ve diğerleri, Maternal Plazma ve Serumda Fetal DNA'nın Kantitatif Analizi: İnvaziv Olmayan Prenatal Tanı için Etkiler, Am J Hum Genet, 62, 768-775 (1998), Lo 1998). fetal genetik özelliklerin invaziv olmayan doğum öncesi teşhisi için fetal hücresiz DNA kullanma olasılığını açtı.

55. Ekim 2003'te, fetal hücre içermeyen DNA'nın analizine dayanan klinik uygulamalar, maternal genomda mevcut olmayan babadan kalıtılan fetal DNA'nın kalitatif tespitine odaklandı. Bu tür uygulamalar arasında X kromozomuna bağlı bozukluk riski taşıyan gebeliklerde Y kromozom dizilerinin saptanması yoluyla cinsiyet testi, RhD negatif annelerin plazma veya serumunda RhD geninin saptanması yoluyla RhD hemolitik hastalık riski taşıyan gebeliklerin belirlenmesi, tanı fötal HLA genlerinin saptanması ve β-talasemi gibi babadan kalıtsal mutasyonlardan kaynaklanan hastalıkların saptanması yoluyla konjenital adrenal hiperplazi gibi insan lökosit antijeni (HLA) ile bağlantılı hastalıkların önlenmesi.

Polimeraz zincirleme reaksiyonu

56. Polimeraz zincir reaksiyonu (PCR), bir DNA sekansının bir şablon DNA sekansından amplifiye edilebildiği (yani bu sekansın çoklu kopyalarının üretilebildiği) bir tekniktir. PCR, ısıya dayanıklı bir DNA polimerazı (yeni DNA iplikleri üreten bir enzimdir) ve DNA sentezinin başlatılması için gerekli olan kısa tek iplikli DNA primerlerini kullanır. Hedef diziyi büyütmek için reaksiyon, reaksiyon karışımında fazla miktarda serbest dNTP (deoksiadenozin-trifosfat, deoksisitidin-trifosfat, deoksiguanozin-trifosfat ve deoksitimidin-trifosfat) varlığında gerçekleşir. Deoksinükleotitler, bir pirofosfat molekülünün serbest bırakılmasıyla yeni DNA ipliklerinin oluşumunda DNA polimeraz tarafından dahil edilir.

57. PCR uygulamaları, termal döngüyü kullanır, burada aşağıdaki adımlar bir PCR döngüsünü oluşturur ve tekrar tekrar gerçekleştirilir:

i) denatürasyon adımı: reaksiyon numunesi, DNA'nın erimesine neden olmak için ısıtılır, bu sayede DNA zincirleri, tek sarmallı şablon DNA molekülleri üretmek üzere ayrılır

ii) tavlama adımı: DNA primerlerinin, primerlere sırayla tamamlayıcı olan tek iplikli şablon DNA bölgelerine tavlanmasına/bağlanmasına izin vermek için reaksiyon numunesi soğutulur ve

iii) uzama aşaması: reaksiyon numunesinin sıcaklığı, DNA polimerazın aktif olduğu bir sıcaklığa yükseltilir ve primerler, şablona bağlı bir şekilde birbiri ardına bir nükleotidin dahil edilmesiyle uzatılır ve yeni bir DNA zinciri tamamlayıcısının DNA sentezi ile sonuçlanır. DNA şablon zincirine.

58. Yeni DNA zincirlerinin amplifikasyonu teorik olarak üsteldir (her döngüde iki katına çıkar), çünkü her yeni zincir bir sonraki sentez turu için bir şablon oluşturur. Bununla birlikte, gerçekte durum böyle olmayacaktır çünkü optimal olmayan reaksiyon koşulları, PCR reaksiyonunun veriminin tipik olarak %100'den az olduğu anlamına gelecektir. PCR reaksiyonunun verimliliği, tavlama ve uzatma sıcaklıkları, polimeraz ve tampon koşulları (iyonik konsantrasyonlar) dahil olmak üzere birçok faktöre bağlı olarak değişecektir.

59. DNA primerleri, karşıt DNA zincirlerine bağlanacak ve ilgili hedefi kuşatacak ve her şablon zincirin hedef dizisine tamamlayıcı olan yeni bir DNA dizisinin sentezini başlatacak şekilde tasarlanmalıdır. Bu primer çiftlerine yaygın olarak ileri ve geri primerler denir.

60. Kantitatif PCR (qPCR), nükleik asitleri ölçmek için PCR kullanımını tanımlamak için kullanılan bir terimdir. Biri gerçek zamanlı nicel PCR olan çeşitli prosedürler kullanılarak gerçekleştirilebilir. Gerçek zamanlı kantitatif PCR, amplifikasyon oluşturmak için reaksiyon numunesindeki flüoresan boyalar (SYBR Green gibi) veya flüoresan problar (TaqMan probları gibi) tarafından oluşturulan bir sinyal ölçülerek amplifiye PCR ürününün birikiminin izlendiği bir PCR içerir. eğri. qPCR'yi aşağıda daha ayrıntılı olarak anlatacağım.

61. Jel elektroforezi, tipik olarak agaroz veya poliakrilamidden oluşan katı bir jel matrisi içinden bir elektrik akımının kullanılmasını içeren bir molekül karışımının (proteinler veya DNA parçaları gibi) analizine yönelik bir tekniktir. DNA fragmanlarının jelden geçme hızı, uzunlukları da dahil olmak üzere çeşitli faktörlere bağlıdır ve daha kısa DNA fragmanları jelden daha büyük fragmanlardan daha hızlı geçer. Jel, DNA ile iç içe geçtiğinde ultraviyole ışık altında floresan olan etidyum bromür gibi bir boya ile boyanabilir ve böylece jeldeki DNA parçalarının görüntülenmesine izin verir. Numunedeki DNA fragmanlarının boyutu, bilinen boyutlarda DNA fragmanlarının bir karışımını içeren bir referans merdiveni kullanılarak belirlenebilir (bakınız aşağıdaki Şekil 11). Jel elektroforezi, ardından jelin bir veya daha fazla bölgesinin kesilmesi ve kesilen bölge(ler) içinde bulunan DNA'nın ekstraksiyonu, belirli boyutlardaki DNA parçalarını izole etmek için kullanılabilir.

62. Santrifüjleme, bir çözeltideki parçacıkların, çözeltiyi bir santrifüjde döndürme yoluyla merkezkaç kuvvetine tabi tutarak boyutlarına, şekillerine ve yoğunluklarına göre ayrılmasını sağlayan bir tekniktir. Bir parçacığın boyutu ve yoğunluğu ile merkezkaç kuvveti altında karışımdan ayrılacağı hız arasındaki korelasyon, santrifüj hızını değiştirerek farklı derecelerde merkezkaç kuvveti uygulayarak farklı boyut ve yoğunluktaki parçacıkların ayrılmasını sağlar. Santrifüj hızı tipik olarak ya dakikadaki devir (RPM) cinsinden ya da yerçekimi birimleri (g) cinsinden ölçülen numuneye uygulanan merkezkaç kuvveti cinsinden belirtilir.

63. Patent canlandırıcı kısa bir belgedir. Spesifikasyon, (Prof Lo tarafından) hamile bir kadının kanının, fetüsten alınan ve maternal plazma veya serumda tespit edilebilen hücre dışı DNA içerdiği ve bunun fetal genetiği tespit etmek için kullanılabileceği bulgusuna atıfta bulunarak, [0001]'de başlar. Maternal genomda bulunmayan lokuslar. [0002]'de spesifikasyon, daha karmaşık fetal genetik lokusların belirlenmesinin daha zor olduğunu, çünkü maternal dolaşımdaki hücre dışı DNA'nın büyük bir kısmının (genellikle %90'dan fazla) anneden kaynaklandığını belirtmektedir. Maternal dolaşımdaki hücre dışı DNA'nın bu büyük yığını, bazı fetal genetik değişiklikleri tespit etmeyi imkansız değilse de zorlaştırır.

64. Spesifikasyon daha sonra buluşu aşağıdaki şekilde tanıtmaktadır:

[0003] Maternal plazmada dolaşımdaki hücre dışı fetal DNA'nın ve dolaşımdaki hücre dışı maternal DNA'nın bir incelemesi, şaşırtıcı bir şekilde, dolaşımdaki hücre dışı fetal DNA'nın çoğunluğunun, yaklaşık 500 baz çifti veya daha az olan nispeten küçük bir boyuta sahip olduğunu, oysa çoğunluğun, şaşırtıcı bir şekilde göstermiştir. anne plazmasındaki dolaşımdaki hücre dışı anne DNA'sı yaklaşık 500 baz çiftinden daha büyük bir boyuta sahiptir. Gerçekten de, belirli durumlarda, yaklaşık 300 baz çiftinden daha küçük olan dolaşımdaki DNA materyali, neredeyse tamamen cenin gibi görünmektedir. Böylece, maternal dolaşımdaki dolaşımdaki hücre dışı fetal DNA'nın, dolaşımdaki hücre dışı maternal DNA'dan (yaklaşık 500 baz çiftinden büyük) daha küçük (yaklaşık 500 baz çifti veya daha az) olduğu bulunmuştur.

[0004] Bu şaşırtıcı bulgu, yaklaşık 500 baz çiftinden daha küçük veya daha küçük olan dolaşımdaki hücre dışı DNA fragmanlarının ayrılmasının, dolaşımdaki hücre dışı maternal DNA'nın büyük yığınından fetal DNA dizileri için zenginleştirme olanağı sağladığına göre mevcut buluşun temelini oluşturur. .

Yaklaşık 500 baz çifti veya daha az olan dolaşımdaki DNA fragmanlarının boyut ayrımına dayanan bu seçici zenginleştirme, büyük ölçüde fetal hücre dışı DNA'dan oluşan bir fraksiyona yol açar. Bu, kromozomal anormallikler (örneğin Down sendromu ile bağlantılı anöploidiler veya kromozomal anormallikler) veya kalıtsal Mendel genetik bozuklukları ve bunlarla bağlantılı genetik belirteçler (örneğin kistik fibroz veya hemoglobinopatiler gibi tek gen bozuklukları) dahil olmak üzere fetal genetik özelliklerin analizine izin verir. ) belirlenmesi, yukarıda belirtildiği gibi, şimdiye kadar imkansız değilse de zor oldu. Anne dolaşımında hücre dışı fetal DNA'nın boyut ayrımı böylece babalık testine izin veren babadan kalıtılan polimorfizmler dahil olmak üzere fetal genetik özelliklerin invazif olmayan tespitini kolaylaştırır.

65. Önceki tekniğin iki maddesini kabul ettikten ve tutarlı bir paragraf belirledikten sonra, şartname şöyle devam eder:

[0008] Bu şekilde elde edilen numune fraksiyonu, HDN için risk altındaki gebeliklerde (fetüsün ve yenidoğanın hemolitik hastalığı) fetal RhD geni gibi geleneksel bir şekilde zaten kolayca saptanabilen fetal genetik özelliklerin sonradan belirlenmesine izin vermekle kalmaz. ) veya hemofili, frajil X sendromu veya benzerleri gibi X kromozomuna bağlı bir bozukluk için risk altındaki gebeliklerde fetal Y kromozomuna özgü sekansların yanı sıra bunlarla sınırlı olmamak üzere diğer, daha karmaşık fetal genetik lokusların belirlenmesi

- kromozomal anormallikler (örneğin anöploidiler veya Down sendromu) veya kalıtsal Mendel genetik bozuklukları ve sırasıyla bunlarla ilişkili genetik belirteçler (örneğin kistik fibroz veya hemoglobinopatiler gibi tek gen bozuklukları)

- babalık belirleneceği zaman belirleyici olabilecek fetal genetik özellikler.

Fetal genetik özelliklerin bu şekilde belirlenmesi, örneğin, PCR (polimeraz zincir reaksiyonu) teknolojisi, ligaz zincir reaksiyonu, prob hibridizasyon teknikleri, nükleik asit dizileri (DNA çipleri olarak adlandırılır) ve benzerleri gibi yöntemlerle gerçekleştirilebilir.

66. İki örnek var. Örnek 1, [0011]-[0021]'de tarif edilmektedir. Özetle, bu aşağıdaki çalışmayı bildirir. Erkek fetüsü olan üçüncü trimester gebeliği olan yedi kadın çalışmaya alındı. Kan örnekleri toplandı ve çift santrifüjlendi (önce 1600 g'de 10 dakika ve sonra süpernatan çıkarıldı ve 10 dakika 16.000 g'de döndürüldü). Plazma örneğinden DNA ekstrakte edildi ve çöktürüldü. Bu DNA daha sonra jel elektroforezi kullanılarak ayrıldı, ardından jel, boyut işaretçilerine göre parçalara ayrıldı. Elde edilen jel parçaları, 90-300 bp (baz çiftleri), 300-500 bp, 500-1000 bp, 1000-1500 bp, 1500 bp-23 kb ve 23 kb'den büyük uzunlukta fragmanlar içeriyordu. Jel parçalarından DNA saflaştırıldı. Son olarak, her jel parçasındaki fetal DNA'yı (SRY geni kullanılarak, amplikon boyutu 78 bp kullanılarak) ve toplam DNA'yı (GAPDH geni kullanılarak, amplikon boyutu 97 bp kullanılarak) qPCR kullanıldı.

67. Beş gebelikten elde edilen sonuçlar Tablo 1'de şu şekilde sunulmaktadır:

68. İkinci sütun, jelin her bir parçasındaki fetal DNA yüzdelerini gösterir. Üçüncü sütun, jelin her bir parçasındaki maternal DNA yüzdelerini gösterir. Spesifikasyon, [0021]'de, ikinci ve üçüncü sütunlardaki rakamların, yüzdelerin medyan değerleri ve parantez içinde, aralıklar olduğunu açıklamaktadır.

69. Spesifikasyon, bu sonuçlarla ilgili şu şekilde yorum yapmaktadır:

Tablo 1, incelenen beş gebelikte, fetüsten kaynaklanan DNA fragmanlarının neredeyse tamamen 500 baz çiftinden daha küçük boyutlarda olduğunu ve 300 baz çiftinden daha küçük boyutlar için yaklaşık %70'inin fetal kaynaklı olduğunu göstermektedir.

Bu sonuçlar, maternal dolaşımda dolaşan fetal orijinli serbest DNA'nın, maternal kandaki toplam serbest DNA'nın boyut ayrımı ile spesifik olarak zenginleştirilebileceğini göstermektedir. Alt uygulamaya bağlı olarak, fetal DNA'nın zenginleştirilmesi için seçilen DNA boyutu, 300 bazdan veya 500 bazdan küçük olacaktır.

70. Spesifikasyon, boyut ayrımından önce fetal fraksiyonun ne olduğunu göstermez. Üçüncü trimester gebelikler için Lo 1998'de yayınlanan %2 ila %11 aralığında olduğunu varsayarsak, yetenekli okuyucu fetal fraksiyonun hem 10 hem de >23 kb olarak zenginleştiğini anlayacaktır (Şekil 1). Bu tür yüksek moleküler ağırlıklı DNA türlerinin mevcudiyeti, plazma örneğinin maternal hücreler tarafından kontamine olmasına atfedilemez, çünkü hücresiz plazma örnekleri elde etmek için çok dikkatli davrandık.

223. Yazarlar ayrıca (sayfa 1008'de):

Toplam dolaşım DNA'sının boyut dağılımı ile ilgili olarak, hamile kadınlarda gözlemlediğimiz modelin, hamile olmayan kadınlardan ve sağlıklı erkek gönüllülerden alınan örneklerde gözlemlenene çok benzer olduğunu belirledik (Şekil 4). Bu analizlerin hiçbirinde, Southern blot analizimizde gözlemlediğimizin aksine, 23 kb moleküler ağırlık markörü tarafından belirtilenden daha büyük bir moleküler boyuta sahip büyük miktarda DNA tespit edemedik (Şekil 1). Bu anormalliğin nedeni, DNA'nın verimli kılcal transfer için gerekli olan küçük parçaları oluşturmak üzere alkali ile muamele edildiği Southern blotlamanın aksine, kullandığımız koşullar altında bu büyük parçaların agaroz jelden kolayca ayrıştırılamamasıdır. .

224. Yazarlar, anne hücrelerinden numune kontaminasyonundan kaçınmak için aşırı özen gösterdiklerini belirtseler de, Prof Thierry'nin görüşü, anne hücre lizizinden kaynaklanan genomik DNA tarafından önemli ölçüde kontamine oldukları yönündeydi. Li 2004 çift santrifüjleme adımı kullansa da, bu tür kontaminasyonun başka kaynakları vardı ve bu tür kontaminasyonun nasıl önleneceğine ilişkin bilgiler 2003/4'ten beri gelişmişti.

225. Eğer Prof Thierry Şekil 1'de 23 kb üzerindeki DNA oranı konusunda doğruysa, bu Li 2004 Tablo 1 ve 2'deki verilerin 23 kb üzerindeki DNA oranını (dolayısıyla 500bp üzerinde) önemli ölçüde eksik temsil etmesi anlamına gelir. ) örneklerde mevcuttu.

226. Prof Thierry, yaklaşık 23 kb'lik banttaki parçaların oranının toplamın %50'si olduğunu tahmin etti. Prof Lovett, bunun, probun tekrarlayan bir dizi için olduğu gerçeğini hesaba katmadığına dikkat çekti; bu, bant yoğunluğunun fragman sayısıyla orantılı olmadığı anlamına gelir (tek kopya genomik bir proba bağlanan bir prob için olacağı gibi). sıra). Prof Lovett bu kanıta itiraz edilmedi. Bunun yerine, çapraz sorguda Prof Lovett'a yöneltilen nokta, oranın %50'den çok daha az olduğu görüşünün, Li'nin yazarlarının "önemli bir oran veya büyük miktarda DNA daha büyük" olduğu konusunda söyledikleriyle tutarsız olduğuydu. 20kb'den fazla. Bunun, Li 2004'ün "önemli bir oran veya büyük miktarlar" ile ne kastettiğine bağlı olduğuna, tahmininin belki yüzde birkaç olduğuna dikkat çekti.

227. Prof Thierry, Southern blot'ta kullanılan Alu probunun bağlanacağı Alu tekrarlarının çoklu kopya doğasının, blotun tepesindeki herhangi bir belirli parçanın karanlığını büyük ölçüde büyüteceği konusunda Prof Lovett'in haklı olduğunu kabul etmek zorunda kaldı. , yani sadece bantların koyuluğuna bakılarak parçaların göreceli sayıları tahmin edilemezdi. Savunmasında, %50'lik oranın sadece bir tahmin olduğunu söyledi, ancak benim görüşüme göre, tahmininin güvenilmez olduğu sonucu çıkıyor.

228. Prof Thierry daha sonra, genomları karşılaştırdığını, oysa Prof Lovett'ın parçaları karşılaştırdığını söyleyerek zemini değiştirdi. Daha sonra bunun doğru bir karşılaştırma olduğunu çünkü dolaşımdaki DNA'nın hücrelerden geldiğini söylese de nedenini tam olarak açıklamadı. Prof Lovett'ın parçaları karşılaştırdığına şüphe yok. Bunu yapmanın yanlış olduğu ona söylenmedi, daha da azı Prof Thierry'nin genomlar hakkındaki görüşü (her ne ise) ona yöneltildi. Ayrıca, Davacıların avukatının işaret ettiği gibi, bu kanıt, Prof Thierry'nin ilk raporunun 21. dipnotunda, parçaları karşılaştırdığını gösteren ifadelere aykırı görünmektedir.

229. Bu nedenle Prof Lovett'in 23kb civarındaki parçaların oranının %50'den çok daha az olduğuna dair kanıtını kabul ediyorum.

230. Li 2004 Tablo 1 ve 2'de verilen rakamların nominal değerde alınması durumunda, 500 bp'de boyut ayrımıyla elde edilen fetal DNA zenginleştirme derecesinin Tablo 1 ve 1.8 için 1.9 kat olacağı yaygın bir görüştür. Prof Thierry'nin tablolara dahil edilmeyen yaklaşık 23 kb'lik parçalar için yaptığı %50 tahminine dayanan görüşü, gerçek rakamların yaklaşık 3,8 kat ve 3,5 kat olduğu yönündeydi. Yukarıda belirtilen nedenlerle %50 rakamını kabul etmiyorum. Davacılar, Şekil 1'in yaklaşık 23 kb'lik bir DNA'nın mevcut olduğunu gösterdiğini ve sonuç olarak, boyut ayrımının bir sonucu olarak fetal DNA'nın zenginleşme derecesinin, Li 2004 Tablo 2'de rapor edilen verilerden daha büyük olacağını kabul etmektedir, çünkü Tablo 23 kb civarındaki DNA'yı hesaba katmaz (Prof Lovett'in belirttiği gibi, Tablo 1 mutlaka aynı pozisyonda durmaz, çünkü hem Şekil 1 hem de Tablo 2 erken gebelikle, Tablo 1 ise geç gebelikle ilgilidir) .

231. Prof Thierry'nin görüşü, 3,8 kat ve 3,5 kat zenginleştirmenin inandırıcı olmadığı ve yukarıda tartışıldığı gibi, sonuçların en olası açıklamasının numunelerin kontaminasyonu olduğuydu. Ancak kanaatime göre, kanıtlar, Li 2004'teki zenginleşme derecesinin rapor edilen verilerde belirtilenden önemli ölçüde daha büyük olacağını göstermez. Prof Thierry, yazarların aşırı özen gösterdiklerini ifade etmelerine rağmen, günümüzde daha iyi numune işleme yöntemleriyle önlenebilecek bazı kontaminasyonlar olduğu konusunda haklı olabilir. Bununla birlikte, önemli derecede kontaminasyon olduğundan memnun değilim.

232.Her halükarda, Davacıların işaret ettiği gibi, Li 2004'teki hiçbir şey, fetal hücresiz DNA'nın boyut dağılımı ile fetal fraksiyonun zenginleştirilmesini sağlayan maternal hücresiz DNA'nın boyut dağılımı arasında bir fark olduğu önermesini zayıflatmaz. 500 bp'de boyut ayrımı yoluyla. Tek soru, elde edilebilecek zenginleşmenin boyutudur.

233. Cheng ve diğerleri, Nanopore Sequencing of Maternal Plasma DNA: Feasibility , Clin Chem , 61(10), 1305-1306 (2015) ile Noninvaziv Prenatal Testing (Cheng 2015), sıralama yapmak için MinION adı verilen bir nanopor sıralama cihazı kullanan bir çalışma bildirmektedir. erkek fetüslere hamile kadınlardan (üçüncü trimester), dişi fetüslere hamile kadınlardan (üçüncü trimester), hamile olmayan kadınlardan ve erkeklerden hücresiz DNA. Dizilenen parçaların maksimum uzunluğu 5776 bp idi.

234. Cheng 2015, dizi okumalarının %0.06'sının 1000bp'den büyük olduğunu bildiriyor (bunun hamile olmayan kadınlarla ilgili olarak hangi örnek(ler) için olduğunu söylemese de). 500bp'den büyük okumaların oranı için herhangi bir rakam vermez, bu nedenle 500 ile 1000bp arasında kaç tane bulduğunu bilmenin bir yolu yoktur.

235. Prof Lovett'in Laver ve arkadaşlarının bir makalesine dayanan kanıtı, Minion cihazının kısa parçaları sıralamaya karşı aşırı derecede önyargılı olduğuydu. Laver'da bu yanlılığı gösteren grafiğin, Cheng 2015 tarafından bulunan 1 kb'nin üzerindeki fragmanların oranının, Li 2004 tarafından bildirilen 1-1.5 kb bandındaki DNA'nın %7.5'inden neden düşük olduğunu açıklamadığı öne sürüldü. Prof Lovett'ın cevabı Cheng 2015'te kullanılan Minion'un sıralama çalışmaları için nasıl ayarlandığını bilmenin bir yolu olmamasıydı, çünkü verdiği boyut dağılımı değiştirilebiliyordu.

236. Davacıların Avukatı, Cheng 2015'teki, kanıtlarda neredeyse hiç keşfedilmemiş farklı bir teknoloji kullanılarak oluşturulan veriler üzerindeki belirsizliklerin, annede hücresiz DNA'nın çok az olduğu veya hiç olmadığı sonucuna varmak için hiçbir temel sağlamadığını ileri sürmüştür. Böyle bir DNA'nın olduğu Chan 2004'ten bilindiği için 500bp'den büyük plazma. Bu gönderiyi kabul ediyorum.

237. Yukarıda ele alınan üç makaleye ek olarak, Prof Thierry, 500bp'nin üzerinde çok az maternal hücresiz DNA olduğu önermesini desteklemek için elektroferogramlar içeren üç rakam ortaya koydu (ikinci raporunda Şekil 1-3). Davalıların avukatı kapanış sunumlarında bu kanıtlara güvenmedi, ancak eksiksiz olması için onunla ilgileneceğim.

238. Chan 2004'ün hamile ve hamile olmayan kadınlar arasında önemli bir fark gösterdiği göz önüne alındığında, Şekil 2 ve 3 hamile kadınlardan alınan numunelerle ilgili değildir ve bu nedenle kanıt niteliğinde değildir. Bu, bekar bir hamile kadının beden profilini gösteren Şekil 1'i bırakır. Bu, boyutlandırma aralığının yalnızca 7 kb'ye kadar olduğu bir teknik kullandı ve her durumda tek bir örnek, Chan'daki istatistiksel olarak güvenilir verilere meydan okumak için neredeyse hiçbir temel sağlamaz.

239. Davacıların avukatının belirttiği gibi, Davalıların inşaat ve yetersizlik arasında, iddialar en az 2.0 kat zenginleştirme ile sınırlı olmadığı sürece, yetersiz kalacak şekilde bir sıkıştırma olduğunu neden söylediğini anlamak zordur. Davalıların Patentte rapor edilen sonuçların kontaminasyon nedeniyle abartılı olduğu iddiası ile inşaat konusu arasında bir bağlantı yok gibi görünüyor.

240. Her ne olursa olsun, iddiaların en az 2.0 misli zenginleştirmeyle sınırlı olmadığı, ancak daha düşük bir zenginleşme derecesini kapsadığı sonucuna vardım. Bu şekilde yorumlandığında, istemlerin Patent tarafından yapılan teknik katkı ile gerekçelendirilenden daha geniş olduğunu kabul etmiyorum. Patent, genel bir teknik fayda ilkesini, yani maternal plazma veya serumdaki fetal hücresiz DNA'nın, 500 bp'de boyut ayrımı ile zenginleştirilebileceğini açıklar. İddiaların genişliği, bu teknik katkı ile orantılıdır. Elde edilebilecek zenginleştirmenin kapsamının durumdan duruma değişebilmesi ve ortalama olarak 2,0 kattan daha az olabilmesi önemsizdir.

241. Davalıların avukatı, iddiaların aşırı genişliğinin, anne plazmasında neredeyse hiç hücresiz DNA'nın 500 bp'nin üzerinde olduğu vakaların olacağı gerçeğiyle kanıtlandığını ileri sürmüştür. Davacıların avukatı bu tür davaların olabileceğini kabul etti, ancak kanıtlara göre bunların çok nadir olabileceğini belirtti, ki buna katılıyorum. Ancak, iddiaları yorumladığım gibi, bu tür plazma örneklerinden türetilen fraksiyonları kapsamamaktadır. Bu tür örneklerden türetilen kesirleri kapsıyor olarak yorumlansa bile iddiaların yetersiz kalacağını kabul etmiyorum. Çok ender durumlarda buluşun pratik bir faydasının olmaması, vakaların büyük çoğunluğunda teknik faydalı olduğu gerçeğini azaltmaz.

242. Davalılar, aksi takdirde geçerli olsalar bile, iddia edilen buluşların, buluş oldukları gerekçesiyle 1977 Yasası'nın 1(2)(a) bölümü uyarınca patent verilebilirlikten hariç tutulduğunu iddia etmektedirler. Ancak Davalılar, yasanın şu anki durumu nedeniyle bu iddianın başarılı olamayacağını kabul etmektedirler. Mahkemeden, hukuk meselesinin gerekirse daha yüksek bir mahkemede tartışılabilmesini sağlamak için uygun olgu tespitleri yapmasını isterler. Davacılar, Davalıların bunlara dayanarak hangi yasal analizleri ilerletmeye çalıştıklarını bilmeden, önerilen olgu bulgularının alaka ve doğruluğuna karar vermenin mümkün olmadığı gerekçesiyle bu kursa itiraz ettiler. En azından Davalıların yasal analizine ilişkin bir açıklama yapılmadığı için, önerilen gerçekler tartışmalıydı.

243. Davalıların ilk olarak öne sürdükleri olgusal bulguya atıfta bulunmak için noktayı açıklamak yeterlidir; bu, aşağıdaki terimlerle ifade edilmektedir:

anne kanı ve içeriği doğal olarak oluşan ürünlerdir.

244. Davacıların Avukatı, anne kanının doğal olarak oluşan bir ürün olduğunu kabul etti, ancak içeriğinin mutlaka doğal olarak oluşan ürünler olduğuna itiraz etti. Bu, kişinin hangi içeriğe atıfta bulunduğuna ve soruyu hangi amaçla sorduğuna bağlı olacaktır. Örneğin, bir plazma numunesi, doğal olarak oluşan bir üründen türetilmiş olmasına rağmen yapay olarak oluşturulmuş bir üründür.

245. Mahkeme'den yasal bir boşlukta olgusal tespitler yapmasının istenmesinin tatmin edici olmadığı konusunda Davacılara katılıyorum. Verdiğim örneğin gösterdiği gibi, Mahkeme'nin yasal değer yargılarıyla yüklenen bulgulara götürülmesi konusunda gerçek bir tehlike vardır. Ayrıca, davalıların avukatı, sadece önerilen bulguların bir bütün olarak deliller üzerine yapıldığını iddia etti. Buna göre, istenen bulguları yapmayı reddediyorum.

246. Harmony Testi, plazma numunelerindeki hücre dışı DNA'nın büyük ölçüde 500 baz çiftinden oluşan DNA'dan oluştuğu bir boyut ayırma adımını içerir. Davalılar tarafından ihlal konusunda tartışılan tek konu, yukarıda 112-113. paragraflarda ele aldığım 2.0 kat zenginleştirme yapısına dayanıyordu. Boyut ayrımının, ortalama olarak, numunede bulunan fetal hücresiz DNA oranının zenginleşmesiyle sonuçlandığı ortak bir zemindi. Zenginleştirmenin ortalama kapsamı üzerinde anlaşmaya varılır, ancak gizlidir. Bu yargıda kesin rakamı belirtmeme gerek yok ama 2.0'dan az. Davalılar, zenginleştirmenin önemli bir bölümünün hücre lizizi ile salınan kontamine anne DNA'sının uzaklaştırılmasından kaynaklandığını iddia etmektedirler. Zenginleşmenin bir kısmının bundan kaynaklandığı ortak bir zemindir. Prof Lovett, kullanılan santrifüjleme yöntemiyle ilgili olarak, zenginleştirmenin yaklaşık 1/6'sının bu etkiye atfedilebildiğine dair tartışmasız kanıtlar verdi. Prof Thierry, ikincil de olsa katkıda bulunan bir faktörün numunelerin karıştırılması olduğunu öne sürdü, ancak bunun Prof Lovett'ın tahmin ettiğinden daha büyük bir fark yarattığı gösterilmedi. Benim kanaatime göre, zenginleştirmenin küçük bir bölümünün, kontamine anne DNA'sının çıkarılmasından kaynaklanması, ihlal konusuyla ilgisizdir. İddia 1'i yorumladığım gibi, TDL bunu ihlal etti.


MALZEMELER VE YÖNTEMLER

LATE-PCR primerleri

için ayrı LATE-PCR primer setleri EGFR Aynı amplifikasyon koşulları altında benzer hazırlama verimleri sergileyen eksonlar 18-21, LATE-PCR tasarım kriterlerine [28,29] uygun olarak Visual OMP yazılımı [33] (sürüm 6.6.0 DNA Software, Inc, Ann Arbor, MI) kullanılarak tasarlandı. . Her amplikon için fazla ve sınırlayıcı LATE-PCR primerleri, Visual OMP yazılımı Tablo I tarafından hesaplandığı üzere, sırasıyla yaklaşık 72'x000b0C ve 75''x000b0C olmak üzere benzer erime sıcaklıklarına sahipti. Elde edilen amplikonların uzunlukları, tipik olarak formalinle sabitlenmiş, parafine gömülü klinik numunelerden elde edilen düşük kaliteli genomik DNA'nın amplifikasyonunu kolaylaştırmak için 220 nükleotidin altında tutuldu [34]. Primerler Biosearch Technologies'den (Novato, CA, ABD) satın alındı. Ekson 18, 19 ve 21 için primerler, her bir eksonu çevreleyen intron dizilerinde bulunur ve her bir ekson için normal ve mutant dizileri benzer verimlilikle çoğaltır (ek bilgi S1). Ekson 20, ekson 18, 19 ve 21'den (%60) daha yüksek bir GC içeriğine sahiptir. Ekson 20 için, diğer amplikonlarınkiyle eşleşen bir erime sıcaklığına sahip bir amplikon üretmek için, ekson 20 primerlerinden biri, Kanserde Somatik Mutasyonlar Kataloğu'na göre, ekson 20'nin içinde bilinen mutasyonu olmayan bir bölgeye yerleştirilir. (KOSMIC) veri tabanı [12]. Primer setleri, multipleks teste entegre edilmeden önce monopleks LATE-PCR reaksiyonlarında özgünlük ve verimlilik için optimize edildi.

Tablo I

Astar AdıTm
(ଌ)
Primer Sırası
Sınırlayıcı primer ekson 18755'x02032 CCCAGAGGCCTGTGCCAGGGACCTTAC 3'x02032
Fazla astar ekson 18725'x02032 CTTGTCTCTGTGTTCTTGTCCCCCCC 3'x02032
Sınırlayıcı primer ekson 19755'x02032 CCATGGACCCCCACACAGCAAAGCAGAAACTCAC 3'x02032
Fazla astar ekson 19725'x02032 GCCAGTTAACGTCTTCCTTCTCTCTCTGTCATA 3'x02032
Sınırlayıcı astar ekson 20745'x02032 TGGGAGCCAATATTGTCTTTGTGTTCCCGGACATAGT 3'x02032
Fazla astar ekson 20725'x02032 GGCCTCTCCCTCCCTCCAG 3'x02032
Sınırlayıcı primer ekson 21755'x02032 AGGAAAATGCTGGCTGACCTAAAAGCCACCTCCTTAC 3'x02032
Fazla astar ekson 21725'x02032 CTCACAGAGGGTCTTCTCTGTTTCAG 3'x02032

Işıklar Açık/Işıklar Kapalı probları

Her bir ekson için bir tane olmak üzere, farklı renklerde dört set Lights-On/Lights-Off probları, amplifikasyonun sonunda aynı geniş sıcaklık aralığında LATE-PCR tek sarmallı ürünlere hibritleşmek üzere tasarlanmıştır (Tablo II). Her set, bir amplikonun primer olmayan dizisini kapsıyordu (tamamlayıcı veri S1). Bazı problar, prob erime sıcaklığını ayarlamak için hedef dizileriyle nükleotit uyumsuzlukları içeriyordu. Lights-On probları, karşı uçlarda bir florofor ve bir söndürücü ile etiketlenmiştir. Bazı Lights-Off probları, 5′ ucunda bir söndürücü içeriyordu ve 3′ ucunda bir C3-bağlayıcı ile bloke edildi. Diğer Lights-Off probları, 3′ ucunda yalnızca bir söndürücü içeriyordu. Bazı özellikle kısa Lights-Off probları, bağlı probların stabilitesini arttırmak için bitişik olarak hibritleştirilmiş problardan gelen söndürücü veya florofor parçaları ile etkileşime giren zıt uçlarda iki söndürücü parçaya sahipti. Bazı Lights-On probları, çift Açık/Kapalı işlevlerine sahip olacak şekilde tasarlanmıştır. Bu problar, bir probun söndürücüsünün diğer Lights-On probunun floroforuna bitişik olacak şekilde hedefe hibritleşir. Bu yöntemle, ikinci Lights-On probunun bağlanması, halihazırda bağlı olan bitişik Lights-On probuna bir Lights-Off probu olarak işlev görür (ek bilgi S1).

Tablo II

İncelemek, bulmakTm
(ଌ)
Prob Sırası5′ Modu.3′ Modu.
Ekson18 AÇIK715'x02032 GGTTGATCTTTTTGAATTCAGTTTCCTT
CAAGATCCTCCC 3′
dostumBHQ-1
Exon18 KAPALI655′ CGGAGCCCAGCACT 3′BHQ-1BHQ-1
Ekson18 AÇIK695'x02032 CAAAGAGAGCTTGGTTGGGAGCT
TTG 3′
BHQ-1dostum
Ekson18 AÇIK595'x02032 GGCTCCACTGGGTGTAAGCC 3'x02032BHQ-1dostum
Exon18 KAPALI615'x02032 AGGCTCCACAAGCTG 3'x02032BHQ-1C3
Ekson19 AÇIK695'x02032 GGACCTTCTGGGATCCAGAGTCC
CCC 3′
Cal-KırmızıBHQ-2
Ekson19 KAPALI625'x02032 ACGGGAATTTTAACTTTCTC 3'x02032-BHQ-2
Ekson19 AÇIK595'x02032 CCGTTTCGGAGATGTTGCTTGG 3'x02032BHQ-2Cal-Kırmızı
Ekson19 KAPALI575'x02032 CTCTTAATTTCTTGATAGCG 3'x02032BHQ-2BHQ-2
Ekson19 AÇIK625'x02032 TTATCGAGGATTTCCTTGTTGGAA 3'x02032BHQ-2Cal-Kırmızı
Exon20 AÇIK595'x02032 GCAGATACCCAGTAGGCGG 3'x02032kuasarBHQ-2
Exon20 KAPALI555'x02032 CTGCATGGTGAAGGTGAG 3'x02032BHQ-2BHQ-2
Exon20 KAPALI645'x02032 GCATGAGCCGCGTGATGAG 3'x02032BHQ-2BHQ-2
Exon20 AÇIK695'x02032 CCAGGGGGCAGCCGAAGG 3'x02032BHQ-2kuasar
Exon21 KAPALI505'x02032 CCAGCATTATGGCTCGCCC 3'x02032BHQ 1C3
Ekson21 AÇIK705'x02032 TTAAATCTGTGATCTTGGCATGCTGC
GGTGAA 3′
Cal-Or.BHQ-1
Ekson21 AÇIK565'x02032 TTTTTGTCTCCCCCTGCATGGTATTCT
TAA 3′
BHQ-1Cal-Or.
Exon21 KAPALI445'x02032 TCCTTCTCTGTACCC 3'x02032BHQ-1C3
Ekson21 AÇIK595'x02032 CCACGGTCCCCCCAAGTAGTTTATGC
CGG 3′
Cal-Or.BHQ-1
Ekson21 KAPALI425'x02032 CTAGGTCTTGGTGGATTGAGCG 3'x02032BHQ-1BHQ-1
Ekson21 AÇIK555'x02032 CCCACCAGTATGTTCCTGGTTGGG 3'x02032BHQ-1Cal-Or.

Kısaltmalar : BHQ-1, Kara Delik Söndürücü 1 BHQ-2, Kara Delik Söndürücü 2 C3, C3 aralayıcı bağlayıcı Cal-Red, Cal-Red 510 Quasar, Quasar 610 Cal-Or., Cal Orange 560.

Lights-On/Lights-Off probları, dördünün hedef dizileri ve ikincil yapıları tarafından dayatılan benzersiz kısıtlamalar dikkate alınarak tasarlanmıştır. EGFR tek sarmallı amplikonlar. Ekson 20'deki 800-823 kodonları için nükleotidler amplikona dahil edilmemiştir çünkü bu dizi, probların daha düşük sıcaklıklarda bağlanmasını önleyen, özellikle yüksek erime sıcaklığında ikincil bir yapı oluşturur. Lights-On/Lights-Off probları, LATE-PCR prensiplerine [28] göre reaksiyonun primer tavlama sıcaklığının (72ଌ) altındaki sıcaklıklarda bağlanmak üzere yapılmıştır. Lights-Off probları ayrıca en yaygın mutasyonlara [6] bağlanmak, alel ayrımını arttırmak için 10-15 nükleotit uzunluğunda olmak ve normal referans imzadan önemli ölçüde sapan mutant floresan imzaları oluşturmak için tasarlanmıştır [30]. Lights-On probları, 20-25 nükleotid uzunluğunda olma eğilimindeydi ve tercihen seyrek mutasyonlara bağlanmak için kullanıldı. Daha yüksek erime sıcaklığına sahip Lights-On probları, daha düşük sıcaklıklarda prob bağlanmasına müdahale edebilecek ikincil yapılar oluşturabilen dizileri bağlamak için de tasarlanmıştır. Son olarak, mümkün olduğunda, normal hedefler üzerinde en basit referans floresan imzasını oluşturmak amacıyla problar yerleştirildi. Mutant imzalar, bu nedenle, karşılaştırıldığında daha belirgin bir şekilde göze çarpıyordu.

Her Işıklar Açık/Işıklar Kapalı prob setinin rengi de sorgulanan mutasyonların sıklığına ve etkisine göre seçildi. Bu nedenle, ekson 18 için Lights-On probları, en zayıf florofor olan FAM ile etiketlendi, çünkü ekson 18'deki TKI duyarlılaştırıcı mutasyonların sıklığı nispeten düşük, %x0003c [6]. Buna karşılık, ekson 20 için Lights-On probları, en kritik TKI-direnç mutasyonları bu ekzonda bulunduğundan, en parlak florofor olan Quasar 670 ile etiketlenmiştir [6]. Lights-On/Lights-Off problarının tasarımına ilişkin diğer ayrıntılar başka bir yerde açıklanmıştır [30,35-37].

Kanser hücre dizilerinden ve NSCLC biyopsilerinden genomik DNA hazırlığı

içeren çeşitli kanser hücre hatları EGFR mutasyonlar American Tissue Culture Collection'dan (ATCC, Manassas, VA) satın alındı. Bu hücre hatlarından genomik DNA'lar, tarif edildiği gibi 10 mM Tris-Cl pH 8.3, 5 µx003bcM SDS ve 0.1 mg/ml Proteinaz K'dan oluşan PCR için optimize edilmiş bir proteinaz K lizis solüsyonu olan Quantilyse kullanılarak hazırlandı [38]. Elde edilen DNA örnekleri, donma ve çözülmeyi önlemek için 4ଌ'de saklandı. Normal ve mutant dizisi EGFR her hücre hattındaki eksonlar 18-21, sekanslama ile doğrulandı.

Doğal olarak oluşan SNP rs1050171 [39] için çeşitli alel konfigürasyonlarına sahip normal genomik DNA EGFR ekson 20 ( <"type":"entrez-nükleotid","attrs":<"text":"NG_007726.3","term_id":"399923581">> NG_007726.3:g.167339GϪ) [40 ] ya Coriell Hücre Depolarından (Camden, New Jersey) satın alındı ​​ya da yukarıda tarif edildiği gibi ATCC kanser hücre dizilerinden hazırlandı ve sekanslama ile doğrulandı. Aşağıdaki örnekler kullanıldı: DNA örnekleri NA10851 (AA genotipi), NA07348 (A/G genotipi) ve NA10855 (GG genotipi) ve hücre hatları HCC827 (AA genotipi) ve HCC4006 (GG genotipi).

Bilinen normal sekanslara ve mutasyonlara sahip formalinle sabitlenmiş, parafine gömülü NSCLC biyopsilerinden elde edilen genomik DNA EGFR COLD-PCR/dizileme analizi [18] tarafından belirlenen ekson 18-21, Dr. Khalid Tobal (Moleküler Onkoloji Birimi, Guys'x02019 Hastanesi, Londra Birleşik Krallık) tarafından sağlanmıştır. Bu numuneler, Pennycuick ve diğerleri tarafından açıklanan yöntemler kullanılarak hazırlandı ve karakterize edildi. [19].

LATE-PCR amplifikasyon koşulları

Multiplex LATE-PCR amplifikasyonları, 1'x000d7 Platinum Taq tamponu (Invitrogen, Carlsbad, CA), 3mM MgCl'den oluşan 25 µx003bcl reaksiyonda gerçekleştirildi.2, her bir deoksinükleotid trifosfattan 400 μM, her bir sınırlayıcı primerden 50 nM, her fazla primerden 1 μM, her bir Lights-On probundan 100 nM, her Lights-Off probundan 300 nM, 2,5 birim Platin Taq DNA polimeraz (Invitrogen, Carlsbad, CA) ve 1-1000 genomik DNA kopyası. Amplifikasyon, 70 döngü için bir Stratagene MX3500P (Agilent Technologies, Santa Clara, CA) içinde gerçekleştirildi. Her döngü, 10 saniye boyunca 99'x000b0C'de denatürasyon, 15 saniye boyunca 72'x000b0C'de primer tavlama ve 30 saniye boyunca 75'x000b0C'de primer uzatmadan oluşuyordu - denatürasyon sıcaklığı, alışılmış 95'x000b0C yerine 99'x000b0C'ye ayarlandı. ekson 20 amplikonun çift sarmallı bileşeninin daha yüksek Tm'si nedeniyle, 96ଌ-. Amplifikasyonun sonunda, 3 dakika boyunca 75ଌ'de son bir uzatma adımı vardı.Son nokta analizi için, Işıklar Açık/Işıklar Kapalı problarının hibridizasyonuna izin vermek için reaksiyon her 30 saniyede 1'lik derecelik düşüşlerle 85'x000b0C'den 35'x000b0C'ye soğutuldu. Bağlı probların dengelenmesi için 35'x000b0C'de 10 dakikalık inkübasyondan sonra, reaksiyon her derecede floresan alımı ile her 30 saniyede 1'x000b0C'lik artışlarla 35'x000b0C'den 85'x000b0C'ye ısıtıldı. Gerektiğinde, dilute‘N’Go yöntemi [31,32] ile dideoksi dizileme için örnekler hazırlandı ve GeneWiz (South Plainfield, NJ) tarafından dizilendi. Sekans analizi, CLUSTAL çevrimiçi programı [41] kullanılarak yapıldı. Normal EGFR NCBI Referans Dizisinden <"type":"entrez-nükleotid","attrs":<"text":"NG_007726.3","term_id":"399923581">> NG_007726.3'ten ekson 18-21 dizileri kullanıldı tüm hücre hatları ve klinik örneklerle karşılaştırma. Silmeler, dizi kromatograflarında, silinen hedef dizinin referans diziye göre çerçeve dışına çıktığı bölgeler olarak tanımlandı.

Her Lights-On probunun konsantrasyonu 100 nM'ye ayarlandı, tüm Lights-On problarının tam bağlanmasını garanti etmek için 70 döngüde LATE-PCR'de üretilen tek iplikli DNA amplikonlarının beklenen maksimum veriminden biraz daha düşük ve her bir Lights-On probunun konsantrasyonunun 300 nM'ye ayarlandığı testin saptama sınırını test eden deney dışında, kopya floresan imzaları [30,35-37] arasındaki farklılıkları en aza indirin. Her bir Lights-Off probunun konsantrasyonu, Lights-On probunun konsantrasyonundan üç kat daha yükseğe ayarlandı ve her bağlı Lights-On probunun yanında hibritleştirilmiş bir Lights-Off probunun olmasını garanti altına aldı [30,35-37] (yani., 300 nM, 600 nM olduğu yerde tahlilin saptama sınırını test eden deney dışında, bu yazıda gösterilen tüm deneyler için).

Mutant ve normal genomların yapay karışımlarını içeren deneyler için, HCC4006 hücre hattından DNA, TKI-duyarlılaştırıcı delesyon taşır. EGFR ekson 19, konsantrasyonda normal hücrelerden alınan genomik DNA ile eşleştirildi (SYBR-Gold ile gerçek zamanlı LATE-PCR amplifikasyonu tarafından oluşturulan Ct değerleri ile teyit edildiği gibi) ve %50, %10, %5, ve %1 mutant DNA. Her örnek, mutant genomların en düşük yüzdesinin (%1), her kopya örneğin mutant genomik DNA içerecek şekilde büyük sayılarda olmasını garanti etmek için toplam 10.000 genom içeriyordu. TKI'ye dirençli mutasyon T790M'yi taşıyan NCI-H1975 hücre hattından DNA için benzer bir mutant ve normal genom karışımları seti hazırlandı.

Veri analizi

Floresan imzalar, sıcaklığa (-dF/dT) göre erime analizinden ham floresan sinyallerinin negatif birinci türevinin, herhangi bir arka plan sinyali çıkarma veya veri normalizasyonu olmaksızın sıcaklığın bir fonksiyonu olarak çizilmesiyle üretildi [30]. Tek istisna, floresan türev değerlerinin, tüm numuneler için ortak olan floresan imzasındaki en yüksek tepe noktasına normalize edildiği Şekil 5B'deki verilerdi. Her bir ekson için mutasyonlar, test örneğinden alınan floresan imzanın şekli ile referans normal örnekten alınan floresan imzanın şekli karşılaştırılarak tanımlandı. Floresan imzalarının tepe ve vadilerinin pozisyonundaki sıcaklık kaymaları nedeniyle, kalıntı örnekler arasındaki gürültünün ötesinde şekil farklılıkları, bir mutasyonun varlığını tanımladı [30]. Sıcaklık kayması olmaksızın floresan imza yoğunluklarındaki farklılıklar, amplikon verimindeki farklılıkları yansıtmaktadır ve bir mutasyonu göstermemektedir [37]. Student's t-testi, %5 mutant genom, %95 normal genomdan oluşan yapay karışımları %100 normal DNA'lı numunelerden ayıran belirli sıcaklıklarda floresan imzalarındaki farkın istatistiksel önemini belirlemek için kullanıldı.

Farklı oranlarda normal ve mutant genomlar içeren yapay karışımlar, %95 normal DNA'da %5 kadar az mutant genomu ayırt eden floresan imzalar üretir. Tüm numuneler kopyalar halinde işlendi ve ayrı ayrı çizildi. Panel A: T790M mutasyonunu taşıyan NCI-H1975 hücre hattından normal DNA ve DNA karışımları. Panel B: 9-baz çifti ekson 19 ΔL747-E749 delesyonunu taşıyan hücre hattı HCC4006 genomik DNA'sından normal DNA ve DNA karışımları. Kara kutu, floresan imzalarının çeşitli DNA karışımları için en ayırt edici olduğu sıcaklık aralığını gösterir. Panellerdeki yüzdeler, her bir karışımdaki mutant genomların yüzdesine karşılık gelir. Her karışım için tekrarlanan floresan imza seti farklı bir renkle etiketlenmiştir. Her panelde örtüşen %1 ve %0 floresan imzaları sırasıyla mavi ve siyah olarak etiketlendi. %5 ve %10 mutant karışımları arasındaki floresan imzalarındaki maksimum fark istatistiksel olarak anlamlıydı (pπ.002).


  1. 1. Ott JJ, Stevens GA, Groeger J, Wiersma ST. Hepatit B virüsü enfeksiyonunun küresel epidemiyolojisi: yaşa özgü HBsAg seroprevalansı ve endemisitesinin yeni tahminleri. Aşı. 201230(12):2212–9. pmid:22273662.
    • Makaleyi Görüntüle
    • PubMed/NCBI
    • Google Akademik
  2. 2. Doo EC, Ghany MG. Klinisyenler için Hepatit B virolojisi. Clin Karaciğer Dis. 201014(3):397–408. epub 2010/07/20. pmid:20638021.
    • Makaleyi Görüntüle
    • PubMed/NCBI
    • Google Akademik
  3. 3. Liang TJ, Block TM, McMahon BJ, Ghany MG, Urban S, Guo JT, et al. Hepatit B'nin mevcut ve gelecekteki tedavileri: Keşiften tedaviye. Hepatoloji. 201562(6):1893-908. pmid:26239691 PubMed Merkezi PMCID: PMC4681668.
    • Makaleyi Görüntüle
    • PubMed/NCBI
    • Google Akademik
  4. 4. Zhu Y, Yamamoto T, Cullen J, Saputelli J, Aldrich CE, Miller DS, et al. Viral DNA sentezinin inhibisyonu sırasında karaciğerden hepadnavirüs kaybının kinetiği. J Virol. 200175(1):311–22. pmid:11119601.
    • Makaleyi Görüntüle
    • PubMed/NCBI
    • Google Akademik
  5. 5. Newbold JE, Xin H, Tencza M, Sherman G, Dean J, Bowden S, et al. Hepadnavirüs genomunun kovalent olarak kapalı dupleks formu, in situ viral minikromozomların heterojen bir popülasyonu olarak bulunur. J Virol. 199569(6):3350–7. Epub 1995/06/01. pmid:7745682 PubMed Central PMCID: PMCPMC189047.
    • Makaleyi Görüntüle
    • PubMed/NCBI
    • Google Akademik
  6. 6. Seeger C, Mason WS. Hepatit B virüsü enfeksiyonunun moleküler biyolojisi. Viroloji. 2015479–480:672–86. pmid:25759099 PubMed Merkezi PMCID: PMC4424072.
    • Makaleyi Görüntüle
    • PubMed/NCBI
    • Google Akademik
  7. 7. Werle-Lapostolle B, Bowden S, Locarnini S, Wursthorn K, Petersen J, Lau G, et al. Kronik hepatit B'nin doğal seyri sırasında cccDNA'nın kalıcılığı ve adefovir dipivoksil tedavisi sırasında düşüş. Gastroenteroloji. 2004126(7):1750–8. pmid:15188170.
    • Makaleyi Görüntüle
    • PubMed/NCBI
    • Google Akademik
  8. 8. Alter H, Block T, Brown N, Brownstein A, Brosgart C, Chang KM, et al. Kronik hepatit B virüsü enfeksiyonunu iyileştirmek için bir araştırma gündemi. Hepatoloji. 201867(3):1127–31. pmid:28877549 PubMed Central PMCID: PMCPMC5873273.
    • Makaleyi Görüntüle
    • PubMed/NCBI
    • Google Akademik
  9. 9. Tang L, Zhao Q, Wu S, Cheng J, Chang J, Guo JT. Hepatit B antiviral ilaç keşfinin mevcut durumu ve gelecekteki yönleri. İlaç keşfi konusunda uzman görüşü. 201712(1):5–15. pmid:27797587.
    • Makaleyi Görüntüle
    • PubMed/NCBI
    • Google Akademik
  10. 10. Chang J, Guo F, Zhao X, Guo JT. Kronik hepatit B virüsü enfeksiyonunun fonksiyonel tedavisi için terapötik stratejiler. Acta pharmaceutica Sinica B. 20144(4):248–57. pmid:26579392 PubMed Central PMCID: PMC4629125.
    • Makaleyi Görüntüle
    • PubMed/NCBI
    • Google Akademik
  11. 11. Nazal M. HBV cccDNA: viral kalıcılık rezervuarı ve kronik hepatit B. Gut. 201564(12): 1972–84. pmid:26048673.
    • Makaleyi Görüntüle
    • PubMed/NCBI
    • Google Akademik
  12. 12. Mason WS, Halpern MS, İngiltere JM, Seal G, Egan J, Coates L, et al. Ördek hepatit B virüsünün deneysel bulaşması. Viroloji. 1983131(2):375-84. Epub 1983/12/01. pmid:6659368.
    • Makaleyi Görüntüle
    • PubMed/NCBI
    • Google Akademik
  13. 13. Tuttleman JS, Pourcel C, Summers J. Hepadnavirüs bulaşmış hücrelerde kovalent olarak kapalı dairesel viral DNA havuzunun oluşumu. Hücre. 198647(3):451–60. Epub 1986/11/07. pmid:3768961.
    • Makaleyi Görüntüle
    • PubMed/NCBI
    • Google Akademik
  14. 14. Wu TT, Coates L, Aldrich CE, Summers J, Mason WS. Ördek hepatit B virüsü ile enfekte olmuş hepatositlerde, viral RNA sentezi için şablon, hücre içi bir yol ile amplifiye edilir. Viroloji. 1990175(1):255–61. pmid:2155510
    • Makaleyi Görüntüle
    • PubMed/NCBI
    • Google Akademik
  15. 15. Guo JT, Guo H. Hepatit B virüsü cccDNA'nın metabolizması ve işlevi: cccDNA'yı hedefleyen antiviral terapötiklerin geliştirilmesi için çıkarımlar. Antiviral Arş. 2015122:91–100. pmid:26272257 PubMed Central PMCID: PMC4586118.
    • Makaleyi Görüntüle
    • PubMed/NCBI
    • Google Akademik
  16. 16. Koniger C, Wingert I, Marsmann M, Rosler C, Beck J, Nassal M. Hepatit B virüslerinin kovalent olarak kapalı dairesel DNA kalıcılık rezervuarının oluşumunda konakçı DNA-onarım enzimi TDP2'nin katılımı. Proc Natl Acad Sci U S A. 2014111(40):E4244–53. epub 2014/09/10. pmid:25201958 PubMed Central PMCID: PMCPMC4209993.
    • Makaleyi Görüntüle
    • PubMed/NCBI
    • Google Akademik
  17. 17. Kitamura K, Que L, Shimadu M, Koura M, Ishihara Y, Wakae K, et al. Flap endonükleaz 1, hepatit B virüsünde cccDNA oluşumunda rol oynar. PLoS Patog'u. 201814(6):e1007124. pmid:29928064.
    • Makaleyi Görüntüle
    • PubMed/NCBI
    • Google Akademik
  18. 18. Long Q, Yan R, Hu J, Cai D, Mitra B, Kim ES, et al. Hepadnavirüs kovalent olarak kapalı dairesel DNA oluşumunda konakçı DNA ligazlarının rolü. PLoS Patog'u. 201713(12):e1006784. pmid:29287110 PubMed Merkezi PMCID: PMCPMC5747486.
    • Makaleyi Görüntüle
    • PubMed/NCBI
    • Google Akademik
  19. 19. Sohn JA, Litwin S, Seeger C. Hepadnavirüslerde CCC DNA sentezi için mekanizma. PLoS Bir. 20094(11):e8093. Epub 2009/12/04. pmid:19956651.
    • Makaleyi Görüntüle
    • PubMed/NCBI
    • Google Akademik
  20. 20. Qi Y, Gao Z, Xu G, Peng B, Liu C, Yan H, et al. DNA Polimeraz kappa, Hepatit B Virüsünün Kovalent Olarak Kapalı Dairesel DNA'sının Oluşumunda Anahtar Hücresel Faktördür. PLoS Patog'u. 201612(10):e1005893. pmid:27783675 PubMed Merkezi PMCID: PMC5081172.
    • Makaleyi Görüntüle
    • PubMed/NCBI
    • Google Akademik
  21. 21. Ko C, Chakraborty A, Chou WM, Hasreiter J, Wettengel JM, Stadler D, et al. Hepatit B virüsü genomu geri dönüşümü ve de novo ikincil enfeksiyon olayları, stabil cccDNA seviyelerini korur. J Hepatol. 201869(6):1231–41. Epub 2018/08/25. pmid:30142426.
    • Makaleyi Görüntüle
    • PubMed/NCBI
    • Google Akademik
  22. 22. Dezhbord M, Lee S, Kim W, Seong BL, Ryu WS. İnsan hepatom hücrelerinin de novo Hepatit B virüsü enfeksiyonunda kovalent olarak kapalı dairesel DNA sentezinin moleküler olaylarının karakterizasyonu. Antiviral Arş. 2019163:11–8. pmid:30639437.
    • Makaleyi Görüntüle
    • PubMed/NCBI
    • Google Akademik
  23. 23. Guo F, Zhao Q, Sheraz M, Cheng J, Qi Y, Su Q, et al. HBV çekirdek proteini allosterik modülatörleri, de novo enfeksiyon ve hücre içi amplifikasyon yollarından cccDNA biyosentezini farklı şekilde değiştirir. PLoS Patog'u. 201713(9):e1006658. pmid:28945802.
    • Makaleyi Görüntüle
    • PubMed/NCBI
    • Google Akademik
  24. 24. Wright GE, Hubscher U, Khan NN, Focher F, Verri A. Buzağı timus DNA polimerazları alfa, delta ve epsilon inhibitör analizi. FEBS Lett. 1994341(1):128–30. Epub 1994/03/14. pmid:8137912.
    • Makaleyi Görüntüle
    • PubMed/NCBI
    • Google Akademik
  25. 25. Gripon P, Cannie I, Urban S. Büyük viral yüzey proteininden türetilen açillenmiş peptitler tarafından hepatit B virüsü enfeksiyonunun etkin şekilde önlenmesi. J Virol. 200579(3):1613–22. pmid:15650187.
    • Makaleyi Görüntüle
    • PubMed/NCBI
    • Google Akademik
  26. 26. Guo H, Jiang D, Zhou T, Cuconati A, Block TM, Guo JT. Hepatit B virüsünün hücre içi proteinden arındırılmış gevşemiş dairesel DNA'sının karakterizasyonu: kovalent olarak kapalı dairesel DNA oluşumunun bir ara maddesi. J Virol. 200781(22):12472–84. Epub 2007/09/07. JVI.01123-07 [pii] pmid:17804499.
    • Makaleyi Görüntüle
    • PubMed/NCBI
    • Google Akademik
  27. 27. Gao W, Hu J. Hepatit B virüsü kovalent olarak kapalı dairesel DNA oluşumu: genom bağlantılı proteinin çıkarılması. J Virol. 200781(12):6164-74. Epub 2007/04/06. pmid:17409153 PubMed Merkezi PMCID: PMCPMC1900077.
    • Makaleyi Görüntüle
    • PubMed/NCBI
    • Google Akademik
  28. 28. Ladner SK, Otto MJ, Barker CS, Zaifert K, Wang GH, Guo JT, et al. Stabil olarak transfekte edilmiş hepatoblastom hücrelerinde insan hepatit B virüsünün (HBV) indüklenebilir ekspresyonu: HBV replikasyonunun potansiyel inhibitörlerini taramak için yeni bir sistem. Antimikrobiyal Ajanlar Chemother. 199741(8):1715–20. pmid:9257747
    • Makaleyi Görüntüle
    • PubMed/NCBI
    • Google Akademik
  29. 29. Sheraz M, Cheng J, Tang L, Chang J, Guo JT. Hepatit B virüsü kovalent olarak kapalı dairesel DNA'nın sentezi için hücresel DNA topoizomerazları gereklidir. J Virol. 2019. pmd:30867306.
    • Makaleyi Görüntüle
    • PubMed/NCBI
    • Google Akademik
  30. 30. Mejlvang J, Feng Y, Alabert C, Neelsen KJ, Jasencakova Z, Zhao X, et al. Yeni histon kaynağı, çoğaltma çatalı hızını ve PCNA boşaltmasını düzenler. J Cell Biol. 2014204(1):29–43. epub 2014/01/01. pmid:24379417 PubMed Merkezi PMCID: PMCPMC3882791.
    • Makaleyi Görüntüle
    • PubMed/NCBI
    • Google Akademik
  31. 31. Lujan SA, Williams JS, Kunkel TA. DNA Polimerazlar Genom Replikasyonunun İşini Bölüyor. Trendler Hücre Biol. 201626(9):640–54. epub 2016/06/06. pmid:27262731 PubMed Central PMCID: PMCPMC4993630.
    • Makaleyi Görüntüle
    • PubMed/NCBI
    • Google Akademik
  32. 32. Lehman IR, Kaguni LS. DNA polimeraz alfa. J Biol Chem. 1989264(8):4265–8. Epub 1989/03/15. pmid:2647732.
    • Makaleyi Görüntüle
    • PubMed/NCBI
    • Google Akademik
  33. 33. Han T, Goralski M, Capota E, Padrick SB, Kim J, Xie Y, et al. Antitümör toksin CD437, DNA polimeraz alfanın doğrudan bir inhibitörüdür. Nat Chem Biol. 201612(7):511–5. epub 2016/05/18. pmid:27182663 PubMed Central PMCID: PMCPMC4912453.
    • Makaleyi Görüntüle
    • PubMed/NCBI
    • Google Akademik
  34. 34. Starokadomskyy P, Gemelli T, Rios JJ, Xing C, Wang RC, Li H, et al. DNA polimeraz-alfa, sitozolik RNA:DNA sentezi yoluyla tip I interferonların aktivasyonunu düzenler. Nat İmmünol. 201617(5):495–504. epub 2016/03/29. pmid:27019227 PubMed Central PMCID: PMCPMC4836962.
    • Makaleyi Görüntüle
    • PubMed/NCBI
    • Google Akademik
  35. 35. Ikegami S, Taguchi T, Ohashi M, Oguro M, Nagano H, Mano Y. Aphidicolin, DNA polimeraz-alfa aktivitesine müdahale ederek mitotik hücre bölünmesini önler. Doğa. 1978275(5679):458–60. Epub 1978/10/05. pmid:692726.
    • Makaleyi Görüntüle
    • PubMed/NCBI
    • Google Akademik
  36. 36. Hendzel MJ, Wei Y, Mancini MA, Van Hooser A, Ranalli T, Brinkley BR, et al. Histon H3'ün mitoza özgü fosforilasyonu öncelikle G2 sırasında pericentromerik heterokromatin içinde başlar ve mitotik kromozom yoğunlaşması ile çakışan düzenli bir şekilde yayılır. Kromozom. 1997106(6):348–60. pmid:9362543.
    • Makaleyi Görüntüle
    • PubMed/NCBI
    • Google Akademik
  37. 37. Guo H, Mao R, Block TM, Guo JT. Hepadnavirüslerin sitoplazmik deproteinize gevşemiş dairesel DNA'sının üretimi ve işlevi. J Virol. 201084(1):387–96. Epub 2009/10/30. JVI.01921-09 [pii] pmid:19864387 PubMed Central PMCID: PMC2798433.
    • Makaleyi Görüntüle
    • PubMed/NCBI
    • Google Akademik
  38. 38. Luo J, Cui X, Gao L, Hu J. Hepatit B Virüsü CCC DNA Oluşumunda Ara Maddenin Tanımlanması ve Hassas ve Seçici CCC DNA Tespiti. J Virol. 2017. pmid:28637752 PubMed Central PMCID: PMCPMC5553186.
    • Makaleyi Görüntüle
    • PubMed/NCBI
    • Google Akademik
  39. 39. Mitra B, Thapa RJ, Guo H, Block TM. Hepatit B virüsünün yaşam döngüsünü tamamlamak için kullandığı konak işlevleri: Kronik hepatit B'yi tedavi etmek için konak hedefleyici ajanlar geliştirmeye yönelik çıkarımlar. Antiviral Res. 2018158:185–98. Epub 2018/08/27. pmid:30145242 PubMed Merkezi PMCID: PMCPMC6193490.
    • Makaleyi Görüntüle
    • PubMed/NCBI
    • Google Akademik
  40. 40. Newbold JE, Xin H, Tencza M, Sherman G, Dean J, Bowden S, et al. Hepadnavirüs genomunun kovalent olarak kapalı dupleks formu, in situ viral minikromozomların heterojen bir popülasyonu olarak bulunur. Viroloji Dergisi. 199569(6):3350–7. pmid:7745682
    • Makaleyi Görüntüle
    • PubMed/NCBI
    • Google Akademik
  41. 41. Liu F, Campagna M, Qi Y, Zhao X, Guo F, Xu C, et al. Alfa-interferon, cccDNA minikromozomlarının epigenetik modifikasyonunu değiştirerek hepadnavirüs transkripsiyonunu baskılar. PLoS Patog'u. 20139(9):e1003613. pmid:24068929 PubMed Central PMCID: PMC3771898.
    • Makaleyi Görüntüle
    • PubMed/NCBI
    • Google Akademik
  42. 42. Avgousti DC, Della Fera AN, Otter CJ, Herrmann C, Pancholi NJ, Weitzman MD. Adenovirüs çekirdek proteini VII, konakçı genom üzerindeki DNA hasar tepkisini aşağı regüle eder. J Virol. 2017. Epub 2017/08/11. pmid:28794020 PubMed Central PMCID: PMCPMC5625504.
    • Makaleyi Görüntüle
    • PubMed/NCBI
    • Google Akademik
  43. 43. Lilley CE, Chaurushiya MS, Boutell C, Everett RD, Weitzman MD. Gelen HSV-1 genomlarına karşı içsel antiviral savunma, spesifik DNA onarım proteinlerini içerir ve viral protein ICP0 tarafından etkisiz hale getirilir. PLoS Patog'u. 20117(6):e1002084. epub 2011/06/24. pmid:21698222 PubMed Merkezi PMCID: PMCPMC3116817.
    • Makaleyi Görüntüle
    • PubMed/NCBI
    • Google Akademik
  44. 44. Hu J, Cheng J, Tang L, Hu Z, Luo Y, Li Y, et al. Kronik Hepatit B. ACS bulaşıcı hastalıklarının Tedavisinin Virolojik Temeli. 2018. pmd:29893548.
    • Makaleyi Görüntüle
    • PubMed/NCBI
    • Google Akademik
  45. 45. Achuthan V, Perreira JM, Sowd GA, Puray-Chavez M, McDougall WM, Paulucci-Holthauzen A, et al. Capsid-CPSF6 Etkileşimi, Viral DNA Entegrasyon Bölgelerine Nükleer HIV-1 Ticaretini Lisanslıyor. Hücre Konak Mikrobu. 201824(3):392–404 e8. epub 2018/09/04. pmid:30173955.
    • Makaleyi Görüntüle
    • PubMed/NCBI
    • Google Akademik
  46. 46. ​​Warburton A, Redmond CJ, Dooley KE, Fu H, Gillison ML, Akagi K, et al. HPV entegrasyonu, yüksek viral onkogen ekspresyonunu harekete geçiren bir viral-hücresel süper güçlendirici oluşturmak için bir hücresel güçlendiriciyi kaçırır ve multimerize eder. PLoS Genet. 201814(1):e1007179. pmid:29364907 PubMed Central PMCID: PMC5798845.
    • Makaleyi Görüntüle
    • PubMed/NCBI
    • Google Akademik
  47. 47. Redmond CJ, Fu H, Aladjem MI, McBride AA. Human Papillomavirus Entegrasyonu: Moleküler Tarama ve Fiber-FISH ile Analiz. Mikrobiyolojide güncel protokoller. 201851(1):e61.pmid:30129235 PubMed Merkezi PMCID: PMC6209533.
    • Makaleyi Görüntüle
    • PubMed/NCBI
    • Google Akademik
  48. 48. Lucifora J, Arzberger S, Durantel D, Belloni L, Strubin M, Levrero M, et al. Hepatit B virüsü X proteini, enfeksiyondan sonra virüs replikasyonunu başlatmak ve sürdürmek için gereklidir. J Hepatol. 201155(5):996–1003. pmid:21376091.
    • Makaleyi Görüntüle
    • PubMed/NCBI
    • Google Akademik
  49. 49. Wang GZ, Wang Y, Goff SP. Histonlar, Nükleer Girişten Kısa Bir süre sonra Bütünleşmemiş Retroviral DNA'lara Hızla Yüklenir. Hücre Konak Mikrobu. 201620(6):798-809. Epub 2016/11/22. pmid:27866901 PubMed Merkezi PMCID: PMCPMC5159289.
    • Makaleyi Görüntüle
    • PubMed/NCBI
    • Google Akademik
  50. 50. Zhu Y, Wang GZ, Cingöz O, Goff SP. NP220, bütünleşmemiş retroviral DNA'nın susturulmasına aracılık eder. Doğa. 2018. Epub 2018/11/30. pmid:30487602.
    • Makaleyi Görüntüle
    • PubMed/NCBI
    • Google Akademik
  51. 51. Schreiner S, Nassal M. Hepatit B Virüsü cccDNA Oluşumunda Konak DNA Hasar Tepkisinin Rolü-ve Ötesi? Virüsler. 20179(5). pmid:28531167 PubMed Merkezi PMCID: PMCPMC5454437.
    • Makaleyi Görüntüle
    • PubMed/NCBI
    • Google Akademik
  52. 52. Mailand N, Bekker-Jensen S, Faustrup H, Melander F, Bartek J, Lukas C, et al. RNF8, DNA çift sarmal kırılmalarında histonları ubiquitile eder ve onarım proteinlerinin birleşmesini destekler. Hücre. 2007131(5):887–900. epub 2007/11/16. pmid: 18001824.
    • Makaleyi Görüntüle
    • PubMed/NCBI
    • Google Akademik
  53. 53. Tsukuda T, Fleming AB, Nickoloff JA, Osley MA. Saccharomyces cerevisiae'de bir DNA çift sarmal kırılma bölgesinde kromatin yeniden şekillenmesi. Doğa. 2005438(7066):379-83. Epub 2005/11/18. pmid:16292314 PubMed Merkezi PMCID: PMCPMC1388271.
    • Makaleyi Görüntüle
    • PubMed/NCBI
    • Google Akademik
  54. 54. van Attikum H, Fritsch O, Hohn B, Gasser SM. INO80 kompleksinin H2A fosforilasyonu ile işe alınması, ATP'ye bağlı kromatin yeniden şekillenmesini DNA çift sarmallı kopma onarımı ile bağlar. Hücre. 2004119(6):777-88. Epub 2004/12/21. pmid:15607975.
    • Makaleyi Görüntüle
    • PubMed/NCBI
    • Google Akademik
  55. 55. Williamson EA, Wray JW, Bansal P, Hromas R. DNA onarımı için histon kodlarına genel bakış. Prog Mol Biol Transl Sci. 2012110:207–27. epub 2012/07/04. pmid:22749147 PubMed Central PMCID: PMCPMC4039077.
    • Makaleyi Görüntüle
    • PubMed/NCBI
    • Google Akademik
  56. 56. Evrin C, Maman JD, Diamante A, Pellegrini L, Labib K. Ökaryotik replizomda Pol alfa tarafından bağlanan Histon H2A-H2B, baskıcı kromatinin korunmasına katkıda bulunur. EMBO J. 201837(19). epub 2018/08/15. pmid:30104407 PubMed Merkezi PMCID: PMCPMC6166128.
    • Makaleyi Görüntüle
    • PubMed/NCBI
    • Google Akademik
  57. 57. Loeb DD, Tian R. Yerinde hazırlamayı artıran mutasyonlar, ördek hepatit B virüsü için sirkülerleşmeyi de azaltır. J Virol. 200175(14):6492–7. pmid:11413316.
    • Makaleyi Görüntüle
    • PubMed/NCBI
    • Google Akademik
  58. 58. Guo H, Xu C, Zhou T, Block TM, Guo JT. Hepadnavirus Kovalent Olarak Kapalı Dairesel (ccc) DNA Oluşumu için Gerekli Konak Faktörlerinin Karakterizasyonu. PLoS Bir. 20127(8):e43270. epub 2012/08/23. PONE-D-12-14952 [pii]. pmid:22912842 PubMed Merkezi PMCID: PMC3418247.
    • Makaleyi Görüntüle
    • PubMed/NCBI
    • Google Akademik
  59. 59. Yang W, Mason WS, Summers J. Dağ sıçanı hepatit virüsü ile enfekte karaciğerde iki tip doğrusal DNA'dan oluşan kovalent olarak kapalı dairesel viral DNA. J Virol. 199670(7):4567-75. pmid:8676483
    • Makaleyi Görüntüle
    • PubMed/NCBI
    • Google Akademik
  60. 60. Yang W, Summers J. Homolog olmayan rekombinasyon yoluyla lineer hepadnavirüs DNA'sının gayri meşru replikasyonu. J Virol. 199569(7):4029–36. pmid:7769660.
    • Makaleyi Görüntüle
    • PubMed/NCBI
    • Google Akademik
  61. 61. Pospiech H, Rytkonen AK, Syvaoja JE. DNA polimeraz aktivitesinin insan homolog olmayan uç birleştirmedeki rolü. Nükleik Asitler Araş. 200129(15):3277-88. Epub 2001/07/27. pmid:11470886 PubMed Central PMCID: PMCPMC55831.
    • Makaleyi Görüntüle
    • PubMed/NCBI
    • Google Akademik
  62. 62. Johnson RE, Klassen R, Prakash L, Prakash S. Hem Lider hem de Gecikmiş DNA Tellerinin Replikasyonunda DNA Polimeraz deltasının Başlıca Rolü. Mol Hücre. 201559(2):163–75. epub 2015/07/07. pmid:26145172 PubMed Central PMCID: PMCPMC4517859.
    • Makaleyi Görüntüle
    • PubMed/NCBI
    • Google Akademik
  63. 63. Mirman Z, Lottersberger F, Takai H, Kibe T, Gong Y, Takai K, et al. 53BP1-RIF1-shieldin, CST ve Polalpha'ya bağlı doldurma yoluyla DSB rezeksiyonunu engeller. Doğa. 2018560(7716):112–6. epub 2018/07/20. pmid:30022158 PubMed Central PMCID: PMCPMC6072559.
    • Makaleyi Görüntüle
    • PubMed/NCBI
    • Google Akademik
  64. 64. MA, Chen M, Acs G satıyor. Klonlanmış hepatit B virüsü DNA'sı ile transfekte edilmiş hepG2 hücrelerinde hepatit B virüsü parçacıklarının üretimi. Proc Natl Acad Sci ABD. 198784:1005–9. pmid:3029758
    • Makaleyi Görüntüle
    • PubMed/NCBI
    • Google Akademik
  65. 65. Cui X, Guo JT, Hu J. Nükleokapsid Kararsızlaştırma ile İlişkili Ölümsüzleştirilmiş Fare Hepatositlerinde Hepatit B Virüsü Kovalent Olarak Kapalı Dairesel DNA Oluşumu. J Virol. 201589(17):9021–8. pmid:26085156 PubMed Central PMCID: PMCPMC4524059.
    • Makaleyi Görüntüle
    • PubMed/NCBI
    • Google Akademik
  66. 66. Raney AK, Eggers CM, Kline EF, Guidotti LG, Pontoglio M, Yaniv M, et al. Hepatosit nükleer faktör 1 alfa-boş hepatit B virüsü transgenik farelerinin karaciğerindeki nükleer kovalent olarak kapalı dairesel viral genomik DNA. J Virol. 200175(6):2900–11. pmid:11222715.
    • Makaleyi Görüntüle
    • PubMed/NCBI
    • Google Akademik
  67. 67. Lempp FA, Qu B, Wang YX, Urban S. İnsan Sodyum Taurokolat Birlikte Taşıyan Polipeptid ile Yeniden Oluşturulan Fare Hepatik Hücre Çizgisinin Hepatit B Virüsü Enfeksiyonu. J Virol. 201690(9):4827–31. pmid:26865711 PubMed Central PMCID: PMCPMC4836309.
    • Makaleyi Görüntüle
    • PubMed/NCBI
    • Google Akademik
  68. 68. Ko C, Chakraborty A, Chou WM, Hasreiter J, Wettengel JM, Stadler D, et al. Hepatit B virüsü genomu geri dönüşümü ve de novo ikincil enfeksiyon olayları, stabil cccDNA seviyelerini korur. J Hepatol. 2018. pmd:30142426.
    • Makaleyi Görüntüle
    • PubMed/NCBI
    • Google Akademik
  69. 69. Lucifora J, Xia Y, Reisinger F, Zhang K, Stadler D, Cheng X, et al. Nükleer hepatit B virüsü cccDNA'nın spesifik ve hepatotoksik olmayan bozunması. Bilim. 2014343(6176):1221–8. pmid:24557838.
    • Makaleyi Görüntüle
    • PubMed/NCBI
    • Google Akademik
  70. 70. Guo F, Tang L, Shu S, Sehgal M, Sheraz M, Liu B, et al. STING'in hepatositlerde aktivasyonu, hepatit B virüsünün replikasyonunu baskılar. Antimikrobiyal Ajanlar Chemother. 201761(10):e00771–17. pmid:28717041.
    • Makaleyi Görüntüle
    • PubMed/NCBI
    • Google Akademik
  71. 71. Petersen J, Dandri M, Mier W, Lutgehetmann M, Volz T, von Weizsacker F, et al. Büyük zarf proteininden türetilen giriş inhibitörleri ile in vivo hepatit B virüsü enfeksiyonunun önlenmesi. Nat Biyoteknoloji. 200826(3):335–41. Epub 2008/02/26. nbt1389 [pii] pmid:18297057.
    • Makaleyi Görüntüle
    • PubMed/NCBI
    • Google Akademik

Konu Alanları

PLOS Konu Alanları hakkında daha fazla bilgi için buraya tıklayın.

Geri bildiriminizi istiyoruz. Bu Konu Alanları bu makale için anlamlı mı? Yanlış Konu Alanının yanındaki hedefi tıklayın ve bize bildirin. Yardım ettiğin için teşekkür ederim!

Konu Alanı "Küçük enterferans yapan RNA" bu madde için geçerli mi? Evet Hayır

Konu Alanı "DNA sentezi" bu madde için geçerli mi? Evet Hayır

Konu Alanı "DNA polimeraz" bu madde için geçerli mi? Evet Hayır

Konu Alanı "DNA onarımı" bu madde için geçerli mi? Evet Hayır

Konu Alanı "DNA çıkarma" bu madde için geçerli mi? Evet Hayır

Konu Alanı "Güney lekesi" bu madde için geçerli mi? Evet Hayır

Konu Alanı "Transfeksiyon" bu madde için geçerli mi? Evet Hayır

Konu Alanı "DNA kopyalama" bu madde için geçerli mi? Evet Hayır


Videoyu izle: v lift ultrasonic bölgesel zayıflama (Haziran 2022).