Bilgi

Tm'den daha yüksek tavlamada PCR amplifikasyonu elde ediliyor!

Tm'den daha yüksek tavlamada PCR amplifikasyonu elde ediliyor!



We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

Bir gradyan pcr'de Tm'den (62.5) yaklaşık 5 derece (67) daha yüksek bir tavlama sıcaklığında amplifikasyon elde ettiğim bir geni yükseltiyorum? Burada yanlış olan ne? Ayrıca, Tm'nin altında denenen tüm sıcaklıklar için yanlış boyutta çok güçlü bir yoğun bant alıyorum. lütfen yardım


Tahmin edilen Tm'den daha yüksek tavlama elde etmek çok yaygındır. Bu sizin durumunuzda bir sorunsa, özellikle düşük sıcaklıklarda yanlış tavlama alıyorsanız, optimum sıcaklığı bulmak için touchdown PCR kullanmayı düşünün. Veya pragmatik olarak, astar tasarımında herhangi bir esnekliğiniz varsa, sadece bir dizi astar sipariş edin ve hepsini deneyin. Primerler bugün ucuzdur ve genellikle tasarım programlarının çalışmayacağını iddia ettiği yerlerde bile çalışan bir set bulacaksınız.


Primerlerin Tm'si PCR koşulları hakkında fazla bilgi vermez. Spesifik olmayan bantlar aldığınızda, daha yüksek sıcaklık denemeye değer.

Geçici denemeniz zaten uzatılacak sıcaklığa yakın, böylece mekik PCR kullanılabilir. Shuttle PCR'nin sadece 2 adımı vardır: DNA'yı eritmek için 94 ila 96 derece ve birlikte tavlama ve uzatma için 68 ila 74 derece.

DMSO veya betain eklemek isteyebilirsiniz. Yanlış tavlamayı azaltmaya yardımcı olabilirler. Spesifik olmayan bantlar beklediğinizden daha küçük ve daha uzunsa, sırasıyla daha uzun ve daha kısa uzatma süreleri size daha iyi sonuçlar verebilir.

Ve unutmayın, astar tasarımı da önemlidir. Şablonunuzda tekrar eden diziler olup olmadığını kontrol edin ve bu dizilerden primerler tasarlamaktan kaçının.


Tm'den daha yüksek tavlama sıcaklığı ile ilgili olarak, genellikle Tm'nin 48.3 derece olduğu T7 primerini kullanırım. Astar, 55 derecelik tavlama sıcaklığında iyi çalışır. Genellikle, PCR reaksiyon tüplerinde primerler fazladır ve kimyasal dengeyi tavlamaya doğru iter. Tahmin ettiğim şey bu.


Astarın TM'si, karışımınızın tuz konsantrasyonundan da etkilenir. PCR gradyanını dener misiniz? Veya Tm hesaplamasını denersiniz ve tuz konsantrasyonunu dikkate alırsınız. http://www.biophp.org/minitools/melting_temperature/demo.php


Touchdown PCR: Bir Primer ve Bazı İpuçları

Touchdown PCR'ı ilk duyduğumda, iniş yapan bir uçak aklıma geldi ve bunun hakkında düşünmek için kötü bir yol olmadığı ortaya çıktı.

Ancak analojilere ve korkunç kelime oyunlarına (başlığa bakın) açık olmasına rağmen, PCR amplifikasyon spesifikliğini geliştirmek için çok kullanışlı bir teknik olan touch-down PCR (TD-PCR), ilk bakışta göründüğünden daha yanıltıcıdır. Bu nedenle, bu makalede touchdown PCR (TD-PCR) hakkında bir başlangıç ​​ve onu mükemmelleştirmek için bazı ipuçları ve referanslar sunacağım.


QPCR ve RT-qPCR

Kantitatif Uç Nokta PCR

PCR ve RT-PCR, biyolojik örnekleri değerlendirmek için genellikle kalitatif bir formatta kullanılır. Bununla birlikte, viral yükün belirlenmesi, terapötik ajanlara verilen yanıtların ölçülmesi ve gen ekspresyonunun karakterize edilmesi gibi çok çeşitli uygulamalar, hedef bolluğun nicel olarak belirlenmesi ile geliştirilebilir. Teorik olarak, PCR'nin üstel doğası göz önüne alındığında, bunu başarmak kolay olmalıdır, çünkü amplifikasyon döngülerinin sayısı ile molekül sayısının logaritması arasında doğrusal bir ilişki vardır. Ancak pratikte, kontaminantlar (inhibitörler), rekabetçi reaksiyonlar, substrat tükenmesi, polimeraz inaktivasyonu ve hedefin yeniden tavlanması nedeniyle amplifikasyon verimliliği azalır. Döngü sayısı arttıkça, amplifikasyon verimliliği düşer ve sonunda bir plato etkisi ile sonuçlanır.

Normalde kantitatif PCR, döngü sayısı ve moleküller arasındaki ilişkinin nispeten doğrusal olması için ölçümlerin plato fazından önce alınmasını gerektirir. Amplifikasyon verimliliğini etkileyebilecek çok sayıda faktör nedeniyle bu nokta farklı reaksiyonlar için ampirik olarak belirlenmelidir. Ölçüm, reaksiyon platosundan önce alındığından, kantitatif PCR, temel PCR'den daha az amplifikasyon döngüsü kullanır. Bu, algılanacak daha az ürün olduğundan nihai ürünün algılanmasında sorunlara neden olabilir.

Amplifikasyon verimliliğini izlemek için birçok uygulama, PCR'ye dahili bir standart içerecek şekilde tasarlanmıştır. Bu tür bir yaklaşım, reaksiyondaki bir &ldquohousekeeping&rdquo geni (yani, karşılaştırılan örnekler arasında sabit ekspresyon seviyelerine sahip bir gen) için spesifik olan ikinci bir primer çiftini içerir (Gaudette ve Crain, 1991 Murphy et al. 1990). Temizlik genlerinin amplifikasyonu, hedef nükleik asit ve reaksiyon bileşenlerinin kabul edilebilir kalitede olduğunu doğrular, ancak ürün boyutundaki farklılıklar veya dahili standart ile nicelleştirilen hedef arasındaki primer tavlama verimliliğindeki farklılıklar nedeniyle amplifikasyon verimliliklerindeki farklılıkları hesaba katmaz.

Kantitatif PCR'nin rekabetçi PCR ve mdasha varyasyonu kavramı bu sınırlamaya bir yanıttır. Rekabetçi PCR'de, reaksiyona bilinen miktarda bir kontrol şablonu eklenir. Bu şablon, deneysel hedef molekülle aynı primer çifti kullanılarak amplifiye edilir, ancak ayırt edilebilir bir ürün verir (örneğin, farklı boyut, kısıtlama sindirim modeli, vb.). Amplifikasyondan sonra kontrol ve test ürünü miktarları karşılaştırılır. Bu yaklaşımlar hedef nükleik asit, tampon bileşenleri ve primer tavlama verimlerinin kalitesini kontrol ederken, kendi sınırlamaları vardır (Siebert ve Larrick, 1993 McCulloch et al. 1995), birçoğunun elektroforez ile nihai analize bağlı olduğu gerçeği dahil.

Her reaksiyonda üretilen amplifikasyon ürününün miktarını ölçmek için çok sayıda floresan ve katı faz tahlili mevcuttur, ancak bunlar genellikle amplifiye edilmiş DNA'yı spesifik olmayan amplifikasyon ürünlerinden ayırt etmekte başarısız olur. Bu analizlerin bazıları, nükleik asit transfer verimlilikleri nedeniyle başka bir değişkeni tanıtan lekeleme tekniklerine dayanırken, diğer tahliller jel elektroforezi ihtiyacını ortadan kaldırmak, ancak gerekli özgüllüğü sağlamak için geliştirilmiştir. Her amplifikasyon döngüsünün sonuçlarını görüntüleme yeteneği sağlayan gerçek zamanlı PCR, elektroforez ile analiz ihtiyacının üstesinden gelmenin popüler bir yoludur.

Kantitatif Gerçek Zamanlı PCR

Bir PCR ürününü saptamak ve nicelendirmek için floresan olarak etiketlenmiş oligonükleotit probları veya primerleri veya floresan DNA bağlayıcı boyaların kullanılması, kantitatif PCR'nin gerçek zamanlı olarak gerçekleştirilmesine izin verir. Özel olarak tasarlanmış cihazlar, hedefi büyütmek için hem termal döngüyü hem de PCR ürün birikimini izlemek için floresan algılamayı gerçekleştirir. DNA bağlayıcı boyaların kullanımı kolaydır ancak spesifik ve spesifik olmayan PCR ürünleri arasında ayrım yapmaz ve multipleks reaksiyonlara elverişli değildir. Floresan etiketli nükleik asit probları, yalnızca belirli PCR ürünleriyle reaksiyona girme avantajına sahiptir, ancak pahalı ve tasarımı zor olabilir. Bazı qPCR teknolojileri, problar yerine floresan etiketli PCR primerleri kullanır.

Floresan DNA bağlayıcı boyaların kullanımı, en kolay qPCR yaklaşımlarından biridir. Boya reaksiyona basitçe eklenir ve floresan her PCR döngüsünde ölçülür. Bu boyaların floresansı, çift sarmallı DNA varlığında çarpıcı biçimde arttığından, DNA sentezi, floresan sinyalinde bir artış olarak izlenebilir. Ancak, PCR koşullarının yalnızca belirli ürün vermesini sağlamak için genellikle ön çalışma yapılmalıdır. Sonraki reaksiyonlarda, spesifik amplifikasyon bir erime eğrisi analizi ile doğrulanabilir. Termal eriyik eğrileri, tüm ürünün daha düşük bir sıcaklıkta (yaklaşık 60°C) çift sarmallı DNA oluşturmasına izin vererek ve sıcaklığı yavaşça denatüre edici seviyelere (yaklaşık 95°C) yükselterek oluşturulur. Ürün uzunluğu ve dizisi erime sıcaklığını (Tm) etkiler, bu nedenle amplikon homojenliğini karakterize etmek için erime eğrisi kullanılır. Spesifik olmayan amplifikasyon, erime eğrisindeki geniş tepe noktaları veya beklenmedik Tm değerlerine sahip tepe noktaları ile tanımlanabilir. Erime eğrisi, spesifik ve spesifik olmayan amplifikasyon ürünlerini ayırt ederek, rutin kullanım sırasında bir kalite kontrol yönü ekler. Prob tabanlı TaqMan® teknolojisi gibi, Taq DNA polimerazın 5&prime&rarr3&prime eksonükleaz aktivitesine dayanan tahlillerle erime eğrilerinin oluşturulması mümkün değildir.

Bazı qPCR stratejileri, DNA hedefini ölçmek için tamamlayıcı nükleik asit probları kullanır. Bu problar ayrıca tek nükleotid polimorfizmlerini saptamak için de kullanılabilir (Lee ve diğerleri. 1993 Bernard ve diğerleri. 1998). Hidroliz, firkete ve basit hibridizasyon probları dahil olmak üzere birkaç genel gerçek zamanlı PCR prob kategorisi vardır. Bu problar, probun biriken PCR ürününe bağlanmasına izin veren tamamlayıcı bir dizi içerir, ancak problar, floresan raportörlerin sayısı ve konumu bakımından farklılık gösterebilir.

Hidroliz probları, 5&prime ucunda bir flor ve 3&prime ucunda bir söndürücü ile etiketlenir ve iki raportör birbirine yakın olduğundan, floresan sinyali söndürülür. Tavlama adımı sırasında, prob, önceki amplifikasyon döngülerinde üretilen PCR ürününe hibritleşir. Elde edilen prob:hedef hibrid, tavlanmış probu bozan ve floru serbest bırakan DNA polimerazın 5&prime&rarr3&prime eksonükleaz aktivitesi için bir substrattır (Hollanda). ve diğerleri. 1991). Flor, enerji emici söndürücünün etkilerinden arındırılır ve reaksiyonun ilerlemesi ve PCR ürününün birikmesi, sonuçta ortaya çıkan floresan artışı ile izlenir. Bu yaklaşımla, üretilen sinyalin istenen PCR ürününün miktarıyla orantılı olduğunu ve spesifik olmayan amplifikasyonun meydana gelmediğini göstermek için nicelleştirme deneylerinden önce ön deneyler yapılmalıdır.

Moleküler işaretçiler olarak da bilinen firkete probları, hedef DNA'yı tamamlayıcı bir diziyle ayrılmış, ters çevrilmiş tekrarlar içerir. Tekrarlar bir firkete yapısı oluşturmak için tavlanır, burada 5&asal uçtaki flor ve 3&asal uçtaki bir söndürücü birbirine çok yakındır, bu da çok az floresan sinyali ile sonuçlanır. Saç tokası probu, probun firkete yapısını korumak yerine tercihen hedef DNA'ya bağlanacağı şekilde tasarlanmıştır. Reaksiyon ilerledikçe, artan miktarda prob biriken PCR ürününe tavlanır ve bunun sonucunda flor ve söndürücü fiziksel olarak ayrılır. Flor artık söndürülmez ve floresan seviyesi artar. Bu tekniğin bir avantajı, firkete problarının hidroliz problarına göre uyumsuzluk olasılığının daha düşük olmasıdır (Tyagi ve diğerleri. 1998). Ancak, sinyalin istenen PCR ürününe özgü olduğunu ve spesifik olmayan amplifikasyonun meydana gelmediğini göstermek için ön deneyler yapılmalıdır.

Basit hibridizasyon problarının kullanımı, iki etiketli prob veya alternatif olarak bir etiketli prob ve bir etiketli PCR primeri içerir. Birinci yaklaşımda, bir sondadaki flor tarafından yayılan enerji, ikinci sondadaki flor tarafından emilir ve bu flor yakınlarda hibritleşir. İkinci yaklaşımda, yayılan enerji, primerin bir parçası olarak PCR ürününe dahil edilen ikinci bir flor tarafından emilir. Bu yaklaşımların her ikisi de enerji alıcısının floresansının artması ve enerji vericisinin floresansının azalması ile sonuçlanır. Hibridizasyon problarının kullanımı, yalnızca bir etiketli prob gerekli olacak şekilde daha da basitleştirilebilir. Bu yaklaşımda, floresansta bir değişiklik meydana getirmek için florun deoksiguanozin ile söndürülmesi kullanılır (Crockett ve Wittwer, 2001 Kurata ve diğerleri. 2001). Etiketli prob, florun hedef dizideki G kalıntılarına yakın olması için tavlanır ve prob tavlaması arttıkça, deoksiguanozin söndürme nedeniyle floresan azalır. Bu yaklaşımla, probun konumu sınırlıdır, çünkü prob, floresan boyanın bir G kalıntısına çok yakın olması için hibritleşmesi gerekir. Basit hibridizasyon problarının avantajı, farklı renklerde florlar ve farklı erime sıcaklıklarına sahip problar kullanılarak hidroliz ve firkete problarından daha kolay çoğullanma yetenekleridir (Wittwer'de gözden geçirilmiştir). ve diğerleri. 2001).

Bazı qPCR stratejileri, DNA hedefini ölçmek için tamamlayıcı nükleik asit probları kullanır. Bu problar ayrıca tek nükleotid polimorfizmlerini saptamak için de kullanılabilir (Lee ve diğerleri . 1993 Bernard ve diğerleri . 1998). Hidroliz, firkete ve basit hibridizasyon probları dahil olmak üzere birkaç genel gerçek zamanlı PCR prob kategorisi vardır. Bu problar, probun biriken PCR ürününe bağlanmasına izin veren tamamlayıcı bir dizi içerir, ancak problar, floresan raportörlerin sayısı ve konumu bakımından farklılık gösterebilir.

QPCR Ürünleri ve Kaynakları

GoTaq® qPCR ve RT-qPCR kitleri, boya bazlı veya prob bazlı gerçek zamanlı PCR yaklaşımları için mevcuttur. GoTaq qPCR Sistemleri, maksimum amplifikasyon verimliliği ve SYBR Green'den daha fazla floresan sağlayan BRYT Green Dye içerir.

GoTaq® Prob Sistemleri, hidroliz probu tabanlı algılama için reaksiyon montajını basitleştiren, kullanıma hazır ana karışımlardır.


Primerlerin neden Tm farkı 5°C'den büyük olmasın? - (29 Eylül 2011 )

İleri primerlerim için Tm 73C ve tersi için 53C'dir.

Astar F
TGCAGGCGCCCCGAGTGCTGC

astar R
CGTCACTAGTGTCGTCTACTA

Tm 73C'nin uzatma sıcaklığından (pfx DNA polimeraz için 68C) bile daha yüksek olmasının yanı sıra, Tm hesaplayıcıları bana Tm sıcaklıkları arasındaki farkın önerilen 5C'den daha büyük olduğunu ve bu nedenle PCR'nin çalışmayacağını söylüyor.

Tm, primerinizin yarısının hangi sıcaklıkta eriyeceğini söyler (yani, şablon DNA'yı bağlamaz). Ta, Tm'den daha düşük olarak seçilir, bu nedenle primerlerinizin çoğu DNA'yı bağlar. Sıcaklıkla ne kadar düşük giderseniz, primerinizin spesifik olmayan bir şekilde (tamamlayıcı olmayan diziye) bağlanma şansı artar. Bu yüzden doğru tavlama sıcaklığını seçmelisiniz, çok yüksek değil (amplifikasyon yok) çok düşük değil (spesifik değil).
Bu kadar farklı Tm'ye sahip primerleriniz varsa, her iki primerin bağlanması için optimum sıcaklığa sahip olamazsınız.
IMO.

Ama işe yarama ihtimali var mı?

Her zaman şans vardır. Tm'yi hesaplamanın birçok yolu vardır ve bazıları çok farklıdır. Ve gerçek durum da şablona ve kim bilir başka nelere bağlıdır.
Ama çok iyimser olmazdım, 20 derece. F primer diziniz yüksek düzeyde kendi kendini tamamlayıcı niteliktedir, bu nedenle onu gevşetmek için daha yüksek Ta'ya ihtiyacınız olacaktır, ancak o zaman R primeriniz muhtemelen DNA'yı hiç bağlamayacaktır.
Deneyebilirsiniz, ancak işe yaramazsa, yeni primerler tasarlamak muhtemelen daha hızlı ve daha ucuz olacaktır.

Trof'un yapmaya çalıştığı noktayı anlıyorum ve PCR işe yaramazsa ve seçeneğiniz varsa, daha yakın Tm değerlerine sahip farklı primerleri yeniden tasarlamaya çalışacağıma katılıyorum. Örneğin, ileri primerinizden son "GC" yi alabilir ve bu, Tm'nizi yaklaşık 8 derece düşürür. Bununla birlikte, çok farklı Tm değerlerine sahip iki primer kullanma seçeneğimin olmadığı ve PCR'nin iyi çalışmasını sağladığım durumlar oldu. Her zaman en düşük Tm primerinizin sınırları içinde çalışmanız gerekir, bu da muhtemelen 50-54 derecelik bir tavlama sıcaklığı kullanmanız gerekeceği anlamına gelir. Ek olarak, yüksek Tm primerlerle çalışmanın denatürasyon adımınızı uzatmak isteyebileceğiniz anlamına geldiğini buldum. Çoğu polimeraz, önerilen bir zaman aralığıyla gelir (örneğin, 10-30 s için 95 derece). 65'in üzerinde bir Tm'ye sahip bir primerim varsa, genellikle döngüdeki denatürasyon adımımı 30 dereceye kadar uzatırım ve bunun yardımcı olduğunu görüyorum.

Gradyan PCR başarısız oldu. Sıcaklıkları 40C'den 65C'ye ayarladım ama herhangi bir bant üretmedi. Ayrıca 2 adımlı bir PCR çalıştırdım, allynspear tarafından önerildiği gibi denatürasyon süresiyle oynadım ama aynı zamanda başarısız oldu. Sanırım yeni primerler tasarlayacağım.


PCR için tavlama sıcaklığını nasıl hesaplarsınız?

Tavlama sıcaklığı (TaPCR için seçilen ) doğrudan primerlerin uzunluğuna ve bileşimine bağlıdır. Genel olarak, T sıcaklığının yaklaşık 5°C altında bir tavlama sıcaklığı kullanmalısınız.m primerlerinizden. Optimum tavlama sıcaklığı (Ta Opt) belirli bir hedef üzerindeki belirli bir primer çifti için aşağıdaki gibi hesaplanabilir: Ta Opt = 0,3 x (Tm astar) + 0,7 x (Tm ürün) &ndash 14.9 burada Tm primer, daha az kararlı primer-kalıp çiftinin erime sıcaklığıdır ve Tm ürünün değeri, PCR ürününün erime sıcaklığıdır [1].

T'ye sahip olmanın bir sonucua iç tek-baz uyumsuzlukları veya kısmi tavlama tolere edilebildiğinden, bir veya her iki primerin amaçlanan hedef dışındaki dizilere tavlanacağı çok düşüktür. Bu, spesifik olmayan PCR amplifikasyonuna yol açabilir ve sonuç olarak istenen ürünün verimini düşürür. Tersine, ne zaman Ta çok yüksekse, reaksiyon verimi düşebilir, çünkü primer tavlama olasılığı önemli ölçüde azalır. Optimal tavlama sıcaklıkları, doğru amplikonun en yüksek ürün verimini verir.


Yüksek Hızlı qPCR – qPCR İşleminizi Daha Hızlı Yapmanın 5 Yolu

Bunlar, kontaminasyon riskini azaltmak için amplifikasyon öncesi ve sonrası adımlar için belirlenmiş alanlar (üç oda kuralı) ve ekipman kullanılarak primerlerin alikotlanması gibi olağan ipuçları değildir. Hadi başlayalım!

1. Şablonunuz için daha yüksek GC içeriği seçin – qPCR hızı buna bağlıdır

Her zaman mümkün olmayabilir, ancak mümkünse amplikonları seçin. daha yüksek GC içeriği. Guanin (G) ve sitozin (C) için ortalama uzama hızının 2.8 kat daha yüksek 75 °C'ye kadar sıcaklıklarda adenin (A) ve timin (T) için olduğundan daha fazladır. En uygun GC içeriği 60%. Burada en yüksek uzama hızları 70°C ile 75°C arasında gözlemlenmiştir (70°C'nin altındaki ve 75°C'nin üzerindeki sıcaklıklarda, uzama oranları neredeyse lineer düşüş göstermiştir).

GC içeriği düşük veya GC içeriği %60'tan fazla olan şablonlar için uzatma oranları düşer. Burada, yüksek GC içeriği, muhtemelen genişleme bölgesinde ikincil yapıların oluşması nedeniyle, düşük GC içeriğinden daha fazla etkiye sahiptir.

Bununla birlikte, çok önemli farklı GC içeriklerini test edin kullanılan polimeraz için. Taq polimerazın doğal ve delesyon varyantı, artan GC içeriğiyle (yaklaşık %80'e kadar) artan uzama oranları gösterirken, bir Pfu polimeraz varyantı, 75°C'de artan GC içeriğiyle azalan uzama oranları gösterdi (Montgomery et al., 2014).

Genel olarak, amplikonun daha yüksek GC içeriğinin her döngünün uzatma süresini azaltıp azaltamayacağını kontrol etmeye değer.

2. qPCR'niz için ana karışımı akıllıca seçin

Hız söz konusu olduğunda, kullanım dTTP yerine dUTP ana karışımda kaçınılmalıdır. Urasilin (U) dahil edilmesi ortalama olarak %50 daha yavaş 65°C'ye kadar sıcaklıklarda T'den daha fazla. Ana karışımdaki U konsantrasyonunun artması, birleşme oranı üzerinde olumlu bir etkiye sahip değildi, hatta azalttı (Montgomery ve diğerleri., 2014).

Ayrıca pH Reaksiyonun miktarı, uzama oranlarını büyük ölçüde etkiler. Ancak ideal aralık dar ve pH 8.5 ve pH 8.7. pH 8.5'in altında, uzatma oranları önemli ölçüde azalır: her pH birimi ile yaklaşık %60. İdeal pH aralığının üzerinde, uzatma oranları daha da önemli ölçüde azalır ve pH 7'de neredeyse tamamen engellenir (Montgomery ve diğerleri., 2013).

Uzatma oranı üzerinde oldukça etkili olan diğer faktörler şunlardır: magnezyum klorür (MgCl2) ve Potasyum klorür (KCL) konsantrasyonları. 3 ila 6 mM'lik yüksek MgCl2 konsantrasyonları, daha yüksek uzama oranlarına yol açar. Spesifik olarak, bir 1.5 mM MgCl2 konsantrasyonunun yaklaşık olarak sonuçlandığı bulunmuştur. %50 azalma 5 mM'lik bir konsantrasyona kıyasla uzama hızının oranı.

yüksek konsantrasyonları KCI, Yine de, polimeraz aktivitesini güçlü bir şekilde inhibe eder. 0 mM'ye kıyasla 37.5 mM'lik bir KCl konsantrasyonunda uzama hızında %70'den fazla düşüş gözlemlendi. En büyük polimeraz aktivitesi, KCl olmadığında veya en düşük konsantrasyonda olduğu zaman bulunmuştur (Montgomery ve diğerleri., 2013 Montgomery ve Wittwer, 2014).

Amplikonun GC içeriği daha yüksek olduğunda, DMSO %5 veya %7,5'te ikincil yapıları azaltarak amplifikasyonu iyileştirebilir. Ancak %10 DMSO kullanımının uzatma oranlarını azalttığı bulunmuştur (Montgomery ve diğerleri.,2014 Montgomery ve Wittwer, 2014)!

Bu nedenle, qPCR hızının pH'ı ve ana karışımın MgCl2 ve KCl konsantrasyonlarını ayarlaması esastır.

Dikkate alınması gereken bir diğer nokta, uygun boya konsantrasyonu qPCR reaksiyonları için. Kovalent olmayan boyalar uzama oranlarını azaltır ve bu boyaların daha düşük bir konsantrasyonunun uzamayı hızlandırdığı gösterilmiştir. Bununla birlikte, daha düşük boya konsantrasyonları, daha düşük sinyal güçleri ile sonuçlanır ve yalnızca qPCR döngüleyicinin optik sensörünün hassasiyeti yeterince büyükse kullanılabilir (Montgomery ve Wittwer, 2014). Yani, pudingin kanıtı yemekte.

3. Döngü süresini azaltın ve sıcaklık farklarını en aza indirin.

qPCR'nizdeki adımlar

NS bir qPCR'nin çalışma süresi büyük ölçüde, döngüleyicinin sıcaklıklar arasında değişmesi gereken süre olan rampa oranlarına bağlıdır. Sıcaklık farklarının azaltılması oldukça etkili olabilir!

Başarılı PCR sonuçlarının adil bir şekilde üretilebileceği gösterilmiştir. geniş zaman koşulları ve sıcaklık aralığı. Bustin (2017), iki farklı qPCR döngüleyici üzerinde bir meme kanseri hücre hattında (MCF-7) rastgele seçilen altı gen için altı farklı qPCR döngü koşulunu test etti. Denatürasyon süresi ve sıcaklıklarının yanı sıra tavlama/uzama süresi ve sıcaklığı oldukça geniş bir şekilde değiştirildi (Tablo 1) ve (şaşırtıcı bir şekilde) eşik döngüsü (Ct) olarak da adlandırılan yaklaşık olarak aynı sayıda kantifikasyon döngüsü (Cqs) üretti.

Tablo 1: İki farklı qPCR döngüleyici üzerinde paralel olarak gerçekleştirilen testler için farklı qPCR reaksiyon koşulları.

Denatürasyon Tavlama/polimerizasyon

95°C 5 saniye 60°C 15 saniye

93°C 1 saniye 60°C 5 saniye

93°C 1 saniye 60°C 1 saniye

90°C 1 saniye 60°C 15 saniye

90°C 1 saniye 60°C 1 saniye

88°C 1 saniye 60°C 1 saniye

Erime eğrisi analizi, döngüleyicilerden birinde Ubiquitin C hariç, tüm farklı koşullarda aynı amplikonların üretildiğini gösterdi.

Sonuç olarak, bu gösterdi ki iyi qPCR sonuçları ile elde edilebilir daha düşük denatürasyon sıcaklıkları ve daha kısa denatürasyon ve tavlama/uzama süreleri! Açıklandığı gibi ayarlanmış koşullarla 40 döngü çalıştırma süresi yalnızca 60% standart koşullara sahip bir koşu süresi (Bustin, 2017).

4. Mükemmel PCR astarı için güvenilir ve test edilmiş tasarım araçlarını seçin ve

qPCR tahlilleri

Eurofins Genomics'in güvenilir ve denenmiş ve test edilmiş PCR astar tasarım araçları orijinal olarak Irv Edelman tarafından yazılmış olan GCG Wisconsin Paketinin "Prime+" ve mükemmel PCR primer ve prob tasarımı.

Genotipleme ve gen ekspresyon deneyleri için uygun PCR primer/prob kombinasyonlarının seçilmesinde, PCR primeri, prob ve amplifiye ürün üzerindeki çeşitli kısıtlamalar dikkate alınır ve qPCR tahlil tasarımımızda kısmen varsayılan değerler olarak önceden tanımlanır. İçin iki katlı qPCR tahlil tasarımı, tüm primerler ve problar tekrar birbirlerine karşı çapraz kontrol edilir. Sonuçlar, en iyi tahmin edilen performans kriterlerine göre puanlanır.

Rahatınız için yapabilirsiniz doğrudan sipariş mağazamızda seçilen PCR primer çiftleri veya PCR primer/prob kombinasyonları.

5. qPCR projenizi hızlandırmak için hızlı PCR primerleri

Eurofins Genomics yüksek kalite NightXpress (q)PCR Primerleri qPCR projenizin tamamlanmasını artıracaktır. Bugün sipariş verin, içinde teslim edilecekler 24 saatten az! Böylece, qPCR tabanlı araştırmanıza neredeyse hemen başlayabilirsiniz.

(q)PCR Primer NightXpress, her tür standart ve gerçek zamanlı PCR için uygundur. Yüksek saflıkta doğru ve güvenilir astar miktarlarını garanti ediyoruz. Ayrıca, bu primerlerin düşük tuz konsantrasyonu, kararlı erime sıcaklıkları (Tm) verir.

qPCR sonuçlarınızın yayınlanmasını hızlandırmak için bonus ipucu:

MIQE yönergelerini kullanın

Kantitatif Gerçek Zamanlı PCR Deneylerinin Yayınlanması için Asgari Bilgi (MIQE) kılavuzlar, verilerin yayınlanmasında tutarlılığı garanti etmek için qPCR deneylerinin tasarımına yönelik yöntemler sağlar. Bu yönergelere uyulması, karşılaştırılabilir ve tekrarlanabilir (deneyler arasında tutarlılık) (Bustin) güvenilir qPCR verilerinin oluşturulmasına yardımcı olacaktır. ve diğerleri., 2009). Aynı zamanda elde etmenize de katkıda bulunacaktır. yayınlanan veriler.

Andreas Ebertz tarafından

- Bustin, S.A. (2017) Polimeraz zincir reaksiyonu nasıl hızlandırılır. Biomol Detect Quantif. 12: 10-4.

- Bustin, SA, Benes, V., Garson, JA, Hellemans, J., Huggett, J., Kubista, M., Mueller, R., Nolan, T., Pfaffl, MW, Shipley, GL, Vandesompele, J ., Wittwer, CT

(2009) MIQE yönergeleri: Kantitatif gerçek zamanlı PCR deneylerinin yayınlanması için minimum bilgi. Klinik. Kimya 55(4): 611–22.


PCR - daha düşük Tm ile azaltılmış bağlama verimliliği? - (29/Şubat 2008 )

PCR için genel kuralın, daha yüksek bir erime sıcaklığının primer bağlanmasının özgüllüğünü arttırdığını (ve primerlerin mükemmelden daha az eşleşen bir diziye bağlanmasını daha zor hale getirdiğini) ve bunun tersi olduğunu biliyorum (yani daha düşük bir sıcaklıkta birçok spesifik olmayan bağlamadan birden fazla bant alabilirsiniz).

Hiç tam tersi olduğunu duyan var mı?? Bir süredir belirli bir primer setiyle sorun yaşıyorum ve bazı durumlarda, daha düşük bir erime sıcaklığı, daha yüksek bir erime sıcaklığında pozitif olan negatiflerle sonuçlanır. Kafam çok karıştı.

PCR için genel kuralın, daha yüksek bir erime sıcaklığının primer bağlanmasının özgüllüğünü arttırdığını (ve primerlerin mükemmelden daha az eşleşen bir diziye bağlanmasını daha zor hale getirdiğini) ve bunun tersi olduğunu biliyorum (yani daha düşük bir sıcaklıkta birçok spesifik olmayan bağlamadan birden fazla bant alabilirsiniz).

Hiç tam tersi olduğunu duyan var mı?? Bir süredir belirli bir primer setiyle sorun yaşıyorum ve bazı durumlarda, daha düşük bir erime sıcaklığı, daha yüksek bir erime sıcaklığında pozitif olan negatiflerle sonuçlanıyor. Kafam çok karıştı.

Olumlu olarak gördüğünüz şeyin gerçekten olumlu olduğundan emin misiniz? Gördüklerinizin belirsiz olması ve sıcaklığı artırdığınızda kaybolması mümkün değil mi??

PCR için genel kuralın, daha yüksek bir erime sıcaklığının primer bağlanmasının özgüllüğünü arttırdığını (ve primerlerin mükemmelden daha az eşleşen bir diziye bağlanmasını daha zor hale getirdiğini) ve bunun tersinin (yani daha düşük bir sıcaklıkta) olduğunu biliyorum. birçok spesifik olmayan bağlamadan birden fazla bant alabilirsiniz).

Hiç tam tersi olduğunu duyan var mı?? Bir süredir belirli bir primer setiyle sorun yaşıyorum ve bazı durumlarda, daha düşük bir erime sıcaklığı, daha yüksek bir erime sıcaklığında pozitif olan negatiflerle sonuçlanıyor. Kafam çok karıştı.

Baskılama-PCR'de (sadece hedefin ters çevrilmiş terminal tekrarlarına karşılık gelen tek bir primer kullanıldı), azaltılmış tavlama sıcaklığı, primer-kalıp tavlamanın etkinliğini azaltabilir.


Polimeraz Zincir Reaksiyonu (PCR)

Polimeraz zincir reaksiyonu (PCR), DNA dizilerini hızla büyütmek için bir yöntemdir. Tipik bir PCR sırasında, şablon DNA (ilgi bölgesini içerir), bir DNA polimerazı ve primerler olan deoksinükleotitler (dNTP'ler) ile karıştırılır. Primerler, ilgili bölgenin yukarı akışındaki şablon DNA ile tamamlayıcı olan ve polimeraz için işe alım bölgeleri olarak hizmet eden kısa DNA parçalarıdır. PCR, bir zamanlar tüplerin çeşitli su banyoları içinde hareket ettirilmesiyle gerçekleştirilmesine rağmen, artık termal döngüleyiciler veya termo döngüleyiciler kullanılarak otomatik olarak kontrol edilen bir dizi sıcaklık döngüsü içerir. Termocycler, hem reaksiyon sıcaklığı hem de her sıcaklık adımının süresi üzerinde sıkı kontrol sağlayarak verimli amplifikasyon sağlar. Tipik bir PCR sırasında, hedef dizinin üstel amplifikasyonunu elde etmek için denatürasyon, tavlama ve uzatma döngüleri tekrarlanır. Denatürasyon, şablon DNA'nın denatürasyonuna neden olmak için numuneleri tipik olarak 94-98°C arasında ısıtmaktan, DNA zincirlerini bir arada tutan hidrojen bağlarını ve baz istifleme etkileşimlerini bozmaktan oluşur. Şeritler ayrıldıktan sonra, primerlerin şablonun tamamlayıcı bölgelerine baz çifti oluşturmasına (veya tavlamasına) izin vermek için sıcaklık tavlama sıcaklığına düşürülür. Tavlama sıcaklığı (tipik olarak 48-72°C arasında), primerlerin erime sıcaklığı (Tm) ile ilgilidir ve PCR'de kullanılan her primer çifti için belirlenmelidir. Uzatma aşaması sırasında (tipik olarak 68-72°C) polimeraz, yeni oluşan bir DNA zinciri oluşturmak için primeri uzatır. Bu işlem birçok kez tekrarlanır (tipik olarak 25-35 döngü) ve her yeni iplik aynı zamanda primerler için bir şablon görevi görebildiğinden, ilgilenilen bölge katlanarak büyütülür. PCR'nin son adımı genellikle daha uzun, tek bir sıcaklık adımıdır (genellikle 68-72°C'de 5-10 dakika), bu da herhangi bir kısmi kopyanın tamamlanmasına ve tüm replikasyon makinelerinin yeni oluşan DNA'dan temizlenmesine izin verir. PCR tamamlandıktan sonra, tüpler makineden çıkarılıncaya kadar ürün bütünlüğünü korumak için termal döngüleyici 4°-10°C'ye ayarlanır.


Tanıtım

Yüksek GC içeriğine (>gt60%) sahip hedef DNA dizilerinin amplifikasyonu, başarılı bir PCR için bir engel olabilir. Bu problem, DNA şablonları içinde saç tokası, self ve cross primer dimer oluşumu gibi ikincil yapıların oluşma olasılığının yüksek olması nedeniyle karmaşık hale gelmektedir. Bu tür yapılar, DNA polimerazı bloke edebilir ve/veya primerlerin şablonlara bağlanmasını önleyebilir ve böylece PCR sırasında yeni DNA zincirinin sentezini sonlandırabilir. Ek olarak, uzun primerler kullanılarak PCR ile yüksek GC içeriğine sahip genlerin klonlanması, yüksek erime sıcaklığı nedeniyle amplifikasyon işlemi için ekstra bir zorluk oluşturabilir (Tm) sitozin ve guanin baz çiftleri arasındaki ekstra hidrojen bağı nedeniyle (Borah, 2011).

Bu problemlerin üstesinden gelmeyi amaçlayan çalışmalar, primerlere, güçlendirici çözümlere ve döngüsel koşullara özel önem verdi. Primerlerin uzunluğunun 15 ile 30 nükleotid kalıntısı (baz) arasında tutulması ve Tm 52 ve 58 °C arasında. (Borah, 2011). Betain, dimetil sülfoksit (DMSO) ve formamid gibi güçlendiricilerin eklenmesi, çift sarmallı DNA sarmallarının erime karakterlerini değiştirerek sarmalların kolay ayrılmasını sağlar. Betain, DNA ipliklerinin denatürasyonu için gereken enerjiyi azaltan bir amino asit analoğudur. DMSO, zincirler arası ve zincir içi yeniden tavlamayı önleyen hidrojen bağı oluşumuna müdahale eder. (Jensen ve diğerleri, 2010 Ralser ve diğerleri, 2006 Rees ve diğerleri, 1993). Formamid, GC açısından zengin hedeflerle çalışırken PCR özgüllüğünü arttırır (Sarkar ve diğerleri, 1990). Döngüsel koşulların modifikasyonu ayrıca, tavlama sıcaklığının optimize edilmesini, Hot start PCR'nin uygulanmasını ve iç içe PCR ve touchdown PCR'nin kullanılmasını içerir (Don ve diğerleri, 1991 Lorenz, 2012).

Daha önce bahsedilen yaklaşımların benimsenmesinde bile, özellikle GC açısından zengin şablonlar, uzun primerler kullanıldığında ve daha uzun ürünleri amplifiye etmeyi hedeflerken, amplifikasyon zorluklarının devam ettiği belirtilmektedir. Ayrıca, yayınlanmış literatürün çoğu, 1 kilobazdan daha az genlerin amplifikasyonu ve tek bir PCR ürünü ile ilgili koşulların optimizasyonu üzerine odaklanmaktadır (Frey ve diğerleri, 2008 Jensen ve diğerleri, 2010 Kumar ve diğerleri, 2014 Mamedov ve diğerleri). ., 2008 Ralser ve diğerleri, 2006), bununla birlikte, birden fazla uzun GC açısından zengin hedefle (>1 kb) çalışmayı ele almıyorlar. Laboratuvarımızdaki birden fazla GC açısından zengin ORF'nin amplifikasyonunu ve klonlanmasını amaçlayan başka bir proje bağlamında mikobakteriyum bovis genome, a standard procedure that enables amplification of these targets simultaneously was required without the need to optimize individual conditions for each target. This provoked us to design this study that tested and compared the PCR amplification of one “difficult” target as a model, Mb0129 itibaren M. bovis, a large-sized gene 1794 bp and a GC content 77.5%, and two relatively “easier” targets, mpb83 (Mb2898) itibaren M. bovis, a 663 bp gene and 63% GC content, and LMHCC_RS00060 itibaren Listeria monocytogenes, a 1617 bp gene and 41.5% GC. Three PCR protocols were designed and experimented with each of the three genes using five different polymerase enzymes in the presence or absence of enhancers.


Destek Bilgisi

S1 Fig. Sequencing workflow using targeted-amplicon sequencing (TAS) (A) and the polymerase-exonuclease-PCR (PEX PCR) method (B).

The TAS workflow consists of two PCR stages in which template-specific primers containing 5’ linker sequences are used to amplify from template DNA. Subsequently, an aliquot of the first PCR is transferred to a second reaction for amplification with primers containing NGS sequencing adapters and a sample-specific barcode. In the PEX PCR method, a modified workflow is used the first stage reaction is truncated after 2 cycles, primers are removed using exonuclease digestion, and the exonuclease-treated reaction mixture is subsequently PCR-amplified with primers containing sequencing adapters and barcodes. AT = annealing temperature ET = Elongation time.

S2 Fig. Effect of 5-nitroindole substitution and amplification strategy on observed microbial community structure and primer utilization patterns.

(A) Non-metric multidimensional scaling (NMDS) plot of lake sediment microbiome, performed at the taxonomic level of family and based on Bray-Curtis similarity (2D stress = 0.02). Samples were rarefied to 4,750 sequences per sample and no transformation was applied. Symbols are color-coded by the diversity (Shannon Index) of reverse primers (ben.e. 806R) detected in the sequences. Maximum possible Shannon index for 18 primers in the primer pool is 2.89. Reactions in which the 806R primer with 5-nitroindole (806R-NI) substitutions was used were less reproducible. (B) Group-average dendogram of observed lake sediment microbial community structure from a single sample as amplification method is altered. gDNA was PCR amplified using the standard TAS reaction and with PEX PCR reactions with and without exonuclease and with and without primers containing 5-nitroindole substitutions. Bray-Curtis similarity scores were generated based on family-level taxonomic classification, generated as described in the text. Data were standardized but not transformed. Clusters containing all three replicates from a single treatment are indicated by a symbol at the node. (C) Dendogram and heatmap of reverse (806R) primer utilization patterns for the same samples. Bray-Curtis similarity was generated based on standardized abundance of each of 18 primer variants present in the reverse primer pool. The heatmap indicates relative abundance of each primer variant for each sample, with primers ordered by increasing theoretical Tm. A separate column (at the very bottom) indicates the relative abundance of variants potentially present when 5-nitroindole primers are used.

S3 Fig. Effect of method and annealing temperature on primer utilization patterns in mock DNA.

Dendogram and heatmap of reverse primer utilization patterns for the mock community analyzed using the TAS and PEX PCR methods, at temperatures from 30°-55°C. Bray-Curtis similarity was generated based on standardized abundance of each of 18 primer variants present in the reverse primer pool. The heatmap indicates relative abundance of each primer variant for each sample, with primers ordered by increasing theoretical Tm. All reactions using the TAS method clustered together (node indicated by a blue circle). Underlined samples are analyzed at the individual template level in S4 Fig.

S4 Fig. Effect of method and annealing temperature on primer utilization patterns for each mock template.

Dendogram and heatmap of reverse primer utilization patterns for the mock community analyzed using the TAS and PEX PCR methods, at temperatures of 45° and 55°C. Bray-Curtis similarity was generated based on standardized abundance of each of 18 primer variants present in the reverse primer pool. The heatmap indicates relative abundance of each primer variant for each template within the mock community DNA pool, with primers ordered by increasing theoretical Tm.

S5 Fig. Effect of annealing temperature on observed microbial community structure and primer utilization patterns.

(A) Group-average dendogram of observed mammalian fecal microbial community structure from a single sample (“Chin”) as PEX PCR stage 1 annealing temperature is altered. Labeled nodes indicate grouping of replicates from a single annealing temperature (* indicates a single replicate from 55°C is included). Bray-Curtis similarity scores were generated based on family-level biological data, generated as described in the text. Data were standardized but not transformed. (B) Dendogram and heatmap of reverse primer utilization patterns for the same samples. Bray-Curtis similarity was generated based on standardized abundance of each of 18 primer variants present in the reverse primer pool. The heatmap (0–75%) indicates the relative abundance of each primer variant for each sample, with primers ordered by increasing theoretical Tm.


Videoyu izle: MFDEN TMYE GEÇMEK İÇİN SEBEPLER, YAŞADIĞIM ZORLUKLAR NELERDİ? MADDE MADDE ANLATIYORUM #2021tayfa (Ağustos 2022).