Bilgi

8.2: Genlerin Maddesi - Biyoloji

8.2: Genlerin Maddesi - Biyoloji


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

Tüm ökaryotik hücrelerin bir çekirdek içerdiği 19. yüzyılın sonlarında anlaşıldı. Aynı zamanda, çekirdeğin genetik bilgi içerdiği fikri çekişme kazanıyordu. 1910'da Albrecht Kossel, adenin, timin, sitozin ve guaninin (dört DNA bazı) yanı sıra RNA'daki urasili keşfettiği için 1910 Nobel Fizyoloji veya Tıp Ödülü'nü aldı. Mendel'in 1865'te sunduğu Kalıtım Kanunları, muhtemelen nicel biyolojinin faydasının pek takdir edilmediği güçlü bir aritmetik ve istatistik dozuna dayandıkları için geniş çapta anlaşılmamıştı. Ancak otuz yıl sonra yeniden keşfedilmeyi takiben, herhangi bir organizmada bilinen kalıtsal özelliklerin sayısı hızla arttı. O zamanlar DNA, yalnızca dört nükleotitten oluşan küçük, basit bir molekül olarak biliniyordu (bkz. DNA Yapısı ek tarihsel perspektif için aşağıda). O halde soru, bu kadar küçük ve basit bir şeyin, bu kadar çok farklı fiziksel özelliğin kalıtımını nasıl açıklayabildiğiydi? Enzim aktivitelerinin morfolojik özelliklerle aynı şekilde kalıtsal olduğunun kabulü, bir gen bir enzim G. W. Beadle, E. L. Tatum ve J. Lederberg'e 1958 Nobel Fizyoloji ve Tıp Ödülü'nü kazandıran hipotez. Enzimlerin daha sonra protein oldukları gösterildiğinde, hipotez şu hale geldi: tek gen bir protein. Proteinlerin bir veya daha fazla polipeptitten oluştuğu gösterildiğinde, son hipotez şu hale geldi: bir gen bir polipeptit. Ancak genler ve proteinler arasındaki bu ilişki, DNA'nın nasıl genetik materyal olabileceğine ışık tutamadı. Aslında, tam tersi! 20'ye kadar farklı amino asitten oluşan zincirler, polipeptitler ve proteinler, belirli bir organizmada artan sayıda kalıtsal özelliği hesaba katmak için yeterli yapısal çeşitlilik potansiyeline sahipti. Bu nedenle, proteinler kalıtım molekülleri için daha olası adaylar gibi görünüyordu.

Burada okuyacağınız deneyler, I. Dünya Savaşı'nın başlangıcında başladı ve 2. Dünya Savaşı'nın hemen sonrasına kadar sürdü. Bu süre zarfında, DNA'nın basit bir tetramer olmadığını, aslında uzun bir polimer olduğunu öğrendik. Bu, sonunda bilimsel topluluğu, sadece dört monomerik birimden oluşmasına rağmen, genetik molekülün protein değil DNA olduğu sonucuna zorlayan çok zekice deneylere yol açtı. Son olarak, klasik eserine bakıyoruz. Watson, Crick, Franklin ve Wilkins Bu, genetik molekülün yapısını ortaya çıkardı.

A. Griffith'in Deneyi

Fred Neufeld1900'lerin başında pnömokok bakterileri üzerinde çalışan bir Alman bakteriyolog, immünolojik olarak üç farklı suş keşfetti. Streptokok pnömonisi (Tip I, II ve III). Virülan suş (Tip III), ölümlerin çoğundan sorumluydu. İspanyol Gribi (grip) pandemi 1918-1920. Bu pandemi 20 ila 100 milyon insanı öldürdü, çünkü birçoğu influenza viral enfeksiyonu, enfekte olmuş bireylerin bağışıklık sistemini zayıflattı ve onları bakteriyel enfeksiyona duyarlı hale getirdi. streptokok pnömonisi.

1920'lerde, Frederick Griffith virulant ile çalışıyordu Vahşi tip (Tip III) ve iyi huylu (Tip II) suşları S. pnömoni. Virülan suş morfolojik olarak büyüdüğü için iki suşun petri kaplarını ayırt etmesi kolaydı. pürüzsüz koloniler, iyi huylu suş oluşurken kaba koloniler. Bu nedenle, iki bakteri suşu olarak adlandırıldı. S ve r, sırasıyla. artık biliyoruz S hücreler bir polisakkarit (mukus) kapsülü ile kaplanır ve kolonilerin pürüzsüz görünmesini sağlar. Tersine, r hücre kolonileri polisakkarit kaplamadan yoksun oldukları için kaba görünürler (parlamazlar).

Griffith, farelere enjekte etmenin S hücreler onları yaklaşık bir gün içinde öldürdü! Ölümcül olmayan enjekte etmek r hücreler ise hiçbir zarara yol açmadı. Daha sonra, farelerin R suşuna maruz kalmalarının belki de S. pnömoni ilk önce onları S hücreleri tarafından ölümcül enfeksiyona karşı bağışık hale getirecekti. 1928'de yayınlanan deney protokolü ve sonuçları aşağıda özetlenmiştir.

Hipotezini test etmek için Griffith farelere R hücreleri enjekte etti. Bir süre sonra onlara S hücreleri enjekte etti. Bununla birlikte, fareleri S.'ye karşı bağışıklama girişimi. Zatürre başarısızdı! S suşu hücreleri enjekte edilen kontrol fareleri ve Önce R suşu hücrelerini ve ardından S hücrelerini alan deney farelerinin tümü kısa sürede öldü! Beklendiği gibi, R hücreleri enjekte edilen fareler yalnızca hayatta kaldı.

Griffith ayrıca farelerinin kanını bakteri hücrelerinin varlığı için kontrol etti:

· İyi huylu enjekte edilen fareler R (kaba) soy hücreleri hayatta kaldı ve farelerden alınan kan besin ortamına kaplandıktan sonra hiçbir bakteri hücresi büyümedi.

· S hücreleri enjekte edilmiş ölü farelerin kanından birçok S hücresi kolonisi gelişti.

Griffith, şekilde gösterilen iki deney daha yaptı:

1. Farelere ısıyla öldürülmüş S hücreleri enjekte etti; beklendiği gibi, bu fareler hayatta kaldı. Bu farelerden alınan kan hiçbir bakteri hücresi içermiyordu. S hücrelerini ısıtmak, pastörizasyonun sütteki bakteriler üzerinde sahip olduğu etkiye sahip olması gerektiği için bu “beklendi”!

2. Griffith ayrıca farelere bir canlı R hücreleri ve ısıyla öldürülmüş S hücrelerinin karışımıs, kombinasyonun, tek başına R hücrelerinin enjekte edilmesinin başarısız olduğu farede bağışıklığı indükleyebileceği umuduyla. Enjekte edilen fareler, aşılanmak şöyle dursun, öldüğünde ve kanlarında bol miktarda S hücresi biriktiğinde, onun şaşkınlığını hayal edebilirsiniz.

Griffith, deneylerinde önemli bir şeyin olduğunu fark etti. Canlı R hücreleri ve ısıyla öldürülmüş S hücrelerinin karışımında, ölü S hücrelerinden salınan bir şey bazı R hücrelerini dönüştürmüştü. Griffith buna "bir şey" adını verdi. dönüştürme ilkesi, ölü S hücrelerinin enkazında bulunan ve bazen birkaç canlı R hücresi tarafından edinilen ve onları öldürücü S hücrelerine dönüştüren bir molekül. Artık R hücrelerinin polisakkarit kaplamadan yoksun olduğunu ve konakçı hücrenin bağışıklık sisteminin ciddi bir enfeksiyon yayılmadan önce R hücrelerine saldırabileceğini ve temizleyebileceğini biliyoruz.

B. Avery-MacLeod-McCarty Deneyi

Griffith, dönüştürme ilkesinin kimyasal kimliğini bilmiyordu. Ancak deneyleri, DNA'nın "genlerin maddesi" olduğunu kanıtlayan çalışmalara yol açtı. 1930'larda geliştirilen gelişmiş moleküler saflaştırma teknikleri ile O. Avery, C. MacLeod ve M. McCarty, R hücrelerini dönüştürdü. laboratuvar ortamında (yani, bir farenin yardımı olmadan!). Isı ile öldürülmüş S hücresi bileşenlerini (DNA, proteinler, karbonhidratlar, lipitler…) saflaştırdılar ve bir test tüpünde R hücreleri üzerindeki her moleküler bileşenin dönüştürme yeteneğini ayrı ayrı test ettiler.

Avery ve arkadaşlarının deneyleri. aşağıda özetlenmiştir.

Sadece DNA fraksiyonu ölü S hücrelerinin bir kısmı dönüşüme neden olabilir, Avery ve ark. DNA'nın olması gerektiği sonucuna vardı. Dönüşüm İlkesi. Bu sonuçlara rağmen, DNA, genlerin maddesi olarak hemen kabul edilmedi. Yapışkan nokta, DNA'nın sadece dört nükleotitten oluşmasıydı. Bilim adamları DNA'nın büyük bir polimer olduğunu bilseler de, DNA'yı yine de o basit molekül, örneğin dört nükleotidin tekrar eden dizilerinden oluşan bir polimer olarak düşündüler:

…AGCTAGCTAGCTAGCTAGCT…

Sadece proteinlerdeki 20 amino asidin görünüşte sonsuz kombinasyonları, bir organizmanın birçok genetik özelliğini açıklamak için gerekli biyolojik özgüllüğü vaat ediyordu. Yapısal çeşitlilikten yoksun olan DNA, protein genleri için sadece bir iskele olarak açıklandı. Mareşal McLuhan'ın ünlü ifadesini uyarlamak için: ortam mesajdır (yani, hava dalgaları yalnızca iletmek, ama mesaj), çoğu hala proteinlerin genetik bilginin aracı olduğuna inanıyordu. birlikte işlevsel mesajın kendisi.

Günün etkili bilim adamlarının bir DNA'yı kabul etme konusundaki isteksizliği dönüştürme ilkesi kaşiflerini hak ettiği Nobel Ödülü konumundan mahrum etti. Yeni kanıtlar bu kabule karşı daha fazla direnişi savunulamaz hale getirdikten sonra, Nobel Komitesi bile Avery ve arkadaşlarının keşifleri için Nobel Ödülü verilmediğini kabul etti. bir hataydı. Alfred Hershey ve Martha Chase'in anahtar deneyleri sonunda proteinlerin gen olduğu fikrini çürüttü.

167 Fare İçi ve Dışı Dönüşüm; Griffith, McCarthy ve ark.

C. Hershey-Chase Deneyi

Biyokimyasal olarak, bakteriyel virüslerin bir protein kapsülü içine alınmış DNA'dan oluştuğu biliniyordu. Bakteriyel virüslerin (bakteriyofaj veya kısaca faj) yaşam döngüsü, aşağıda gösterildiği gibi bir bakterinin enfeksiyonu ile başlar.

Fajlar, bakteri hücrelerine bağlanana ve onları enfekte edene kadar inert parçacıklardır. Bir bakteri kültürüne eklenen faj parçacıklarının bir elektron mikroskobunda bakteri yüzeylerine yapıştığı görülebilir. Müfettişler, bir karıştırıcıda (mutfağınızdakine benzer şekilde) çalkalayarak bakterilerden faj parçacıklarını ayırabileceklerini buldular. Santrifüjleme daha sonra bakteri hücrelerini santrifüj tüpünün altındaki bir pelet içinde ayırdı ve ayrılan faj partiküllerini süpernatanda bıraktı. Bakterilere faj ekleyerek ve ardından farklı zamanlarda fajı bakterilerden ayırarak, bakteriler enfekte olmadan önce fajın ne kadar süreyle bağlı kalması gerektiğini belirlemek mümkün oldu. Kısa süreler için faja bağlanan peletlenmiş hücrelerin, büyüme ortamında yeniden süspanse edildiklerinde hayatta kalacağı ve çoğalacağı ortaya çıktı. Ancak daha uzun süre faja bağlı bırakılan topaklanmış hücreler enfekte olmuştu; Ayrılmış fajdan santrifüj olarak ayrılmış ve taze ortamda yeniden süspanse edildiğinde, bu hücreler devam edecek ve yeni faj üreterek parçalanacaktır. Bu nedenle, virüsten faja virülans için genetik bilginin transferi biraz zaman aldı. Enfeksiyon ve virülanstan sorumlu viral genetik materyal, görünüşe göre artık santrifüj süpernatandan geri kazanılabilen faj kapsülü ile ilişkili değildi.

Alfred Hershey ve Martha Chase, aşağıdakilerin olup olmadığını belirlemek için bir deney tasarladılar. DNA viral tarafından kapatılmış protein kapsülü veya kapsül proteininin kendisi fajın bakteriyi enfekte etmesine neden olmuştur. Deneyde, ayrı ayrı büyüdüler E. koli ile enfekte hücreler T2 bakteriyofaj birinin huzurunda 32P veya 35S (radyoaktif sırasıyla fosfor ve kükürt izotopları). Sonuç, ya radyoaktif DNA ya da radyoaktif proteinler içeren, ancak ikisini birden içermeyen faj üretmekti (yalnızca DNA'nın fosfor içerdiğini ve yalnızca proteinlerin kükürt içerdiğini hatırlayın). Daha sonra ayrı ayrı enfekte taze E. koli ya ile hücreler 32P- veya 35S etiketli, radyoaktif faj. Onların deneyi aşağıda açıklanmıştır.

Faj ve hücreler, enfeksiyona izin verecek kadar uzun süre 32P veya 35S ile inkübe edildi. Her kültürün bir kısmının, hücrelerin enfekte olduğunu kanıtlamak için devam etmesine ve parçalanmasına izin verildi. Her karışımın geri kalanı blendere gönderildi. Her harmanın santrifüjlenmesinden sonra, radyoaktif proteinlerin veya DNA'nın nereye gittiğini görmek için peletler ve süpernatanlar incelendi. Sonuçlara göre, 32P her zaman bakteri hücrelerinin peletinde bulunurken, 35S süpernatandaki faj kalıntısında bulundu. Hershey ve Chase, bakteriyel virüslerin genetik materyalinin protein değil DNA olduğu sonucuna vardılar, tıpkı Avery ve diğerleri gibi. DNA'nın bakteriyel dönüştürücü ilke olduğunu öne sürmüştü.

Genetik materyal olan "basit" DNA'ya karşı daha önceki direnç göz önüne alındığında, Hershey ve Chase, sonuçlarını çerçevelerken temkinli bir dil kullandılar. sahip olmaları gerekmez; sonraki tüm deneyler, DNA'nın genetik materyal olduğunu doğruladı. Bu doğrulamalarla eşzamanlı olarak, DNA'nın bu kadar basit, karmaşık olmayan bir molekül olmayabileceğini (aslında, olmadığını) gösteren deneyler de vardı! Alfred D. Hershey, DNA'yı "genlerin maddesi" olarak saptamaya yaptıkları son katkılardan dolayı, 1969 Nobel Fizyoloji veya Tıp Ödülü'nü Max Delbruck ve Salvador E. Luria ile paylaştı.

168 Hershey ve Chase: Viral Genler Viral DNA'dadır


8.2: Genlerin Maddesi - Biyoloji

Amaç: Resimleri analiz ederek ve gözlemler yaparak, YWBAT: Ekolojistlerin ekosistemleri düzenlemek için kullandıkları kategorileri tanımlayın ve açıklayın.

  • Beşinci sınıf
    Altıncı sınıf, Yedinci sınıf, Sekizinci sınıf 3 daha. , Altıncı sınıf, Yedinci sınıf, Sekizinci sınıf
  • 53,451 Görüntüleme
  • 6 Favoriler

Biyotik ve abiyotik faktörlerin tanıtılması

Amaç: YWBAT: 1)Canlı ve cansız varlıklar arasındaki farkı tanımlar ve açıklar 2)Biyotik, abiyotik ve ekolojiyi tanımlar

8.26 Sınıf Büyük Hedefi ve Laboratuvar Ekipmanlarının Gözden Geçirilmesi

Boston Collegiate Charter School'dan Rachel Ryland

Amaç: - Büyük hedefimizi açıklayın. - Laboratuvar ekipmanlarını tanımlayın. - Her bir ekipmanın neyi ölçmek için kullanıldığını ve ölçüldüğü birimleri açıklayın.

3.23 Kalıtım ve Genetik Değerlendirme

Boston Collegiate Charter School'dan Rachel Ryland

Amaç: Öğrenciler, kalıtım ve genetik ünitesindeki hedeflere hakim olduklarını göstereceklerdir.

9.21 Hücre Türleri

Boston Collegiate Charter School'dan Rachel Ryland

Amaç: Prokaryotik ve ökaryotik hücreleri ayırt eder. Hücre zarının yapısını ve işlevini açıklar.

  • Altıncı sınıf
    Yedinci sınıf, Sekizinci sınıf 2 daha. , Yedinci sınıf, Sekizinci sınıf
  • 6,711 Görüntüleme
  • 5 Favoriler

Nüfus örnekleme yöntemleri

Amaç: YWBAT: Belirli bir türün popülasyon büyüklüğünü tahmin etmek için kullanılan çeşitli yöntemleri açıklayın.

Cep Faresi Örneği - Doğal Seleksiyon

3.14 Monohibrit Haçlar

Boston Collegiate Charter School'dan Rachel Ryland

Amaç: Dominant/resesif ilişkiyi monohibrit genetik problemine uygular.

8.27 Laboratuvar Güvenliği ve BCCS Bilimi Büyük Fikirler

Boston Collegiate Charter School'dan Rachel Ryland

Amaç: - Sınıf için laboratuvar güvenlik prosedürlerini ve bunların önemini açıklayın. - BCCS biliminin 6 büyük fikrini tanımlayın.

  • Beşinci sınıf
    Altıncı sınıf, Yedinci sınıf, Sekizinci sınıf 3 daha. , Altıncı sınıf, Yedinci sınıf, Sekizinci sınıf
  • 32,627 Görüntüleme
  • 6 Favoriler

Yemek zinciri

Amaç: YWBAT:
1) Bir besin zinciri oluşturun
2) Üretici, tüketici ve ayrıştırıcı arasındaki farkı açıklayın

  • Altıncı sınıf
    Yedinci sınıf, Sekizinci sınıf 2 daha. , Yedinci sınıf, Sekizinci sınıf
  • 11,778 Görüntüleme
  • 2 Favoriler

Toplam nüfus büyüklüğü ve nüfus yoğunluğunun hesaplanması

Amaç: YWBAT: Nüfus yoğunluğunu hesaplayın

3.21 İstilacı Türler

Boston Collegiate Charter School'dan Rachel Ryland

Amaç: İstilacı (yerli olmayan) bir türün ne olduğunu belirleyin. İstilacı türlerin alanları nasıl olumsuz etkileyebileceğini açıklayın ve ardından girin.

  • Sekizinci sınıf
    Dokuzuncu sınıf, Onuncu sınıf, Onbirinci sınıf, Onikinci sınıf, Üniversiteye Hazırlık. 5 daha. , Dokuzuncu sınıf, Onuncu sınıf, Onbirinci sınıf, Onikinci sınıf, Üniversiteye Hazırlık.
  • 8,065 Görüntüleme

Evrimdeki "I": Biyolojik Bireysellik

Liderlik Hazırlık Yüksek Okulundan Anke al-Bataineh

Amaç: Öğrenciler, genetik varyasyonların popülasyonlar içinde bireyselliğe nasıl yol açtığını anlar.

  • Sekizinci sınıf
    Dokuzuncu sınıf, Onuncu sınıf, Onbirinci sınıf, Onikinci sınıf, Üniversiteye Hazırlık. 5 daha. , Dokuzuncu sınıf, Onuncu sınıf, Onbirinci sınıf, Onikinci sınıf, Üniversiteye Hazırlık.

2.7 mayoz bölünme

Boston Collegiate Charter School'dan Rachel Ryland

Amaç: Diyagram mitoz. Mayoz bölünme sürecini açıklayınız.

  • Sekizinci sınıf
    Dokuzuncu sınıf, Onuncu sınıf, Onbirinci sınıf, Onikinci sınıf, Üniversiteye Hazırlık. 5 daha. , Dokuzuncu sınıf, Onuncu sınıf, Onbirinci sınıf, Onikinci sınıf, Üniversiteye Hazırlık.
  • 2,667 Görüntüleme

Bir Dünya Görüşü Nasıl "Satılır"

Liderlik Hazırlık Yüksek Okulundan Anke al-Bataineh

Amaç: Öğrenciler, bireyselcilik veya kolektivizm için ikna edici bir "perde" geliştirmek için kurumsal, politik ve kişilerarası dünyalardan modeller kullanırlar.


Welch RA, Burland V, Plunkett G, Redford P, Roesch P, Rasko D, Buckles EL, Liou SR, Boutin A, Hackett J, ve diğerleri: Üropatojenik tam genom dizisi tarafından ortaya çıkarılan kapsamlı mozaik yapı Escherichia koli. Proc Natl Acad Sci ABD. 2002, 99: 17020-17024. 10.1073/pnas.252529799.

Rasko DA, Ravel J, Okstad OA, Helgason E, Cer RZ, Jiang L, Shores KA, Fouts DE, Tourasse NJ, Angiuoli SV, ve diğerleri: Bacillus cereus ATCC 10987, metabolik adaptasyonları ve bununla ilgili büyük bir plazmidi ortaya çıkarır. Bacillus anthracis pXO1. Nükleik Asitler Araş. 2004, 32: 977-988. 10.1093/nar/gkh258.

Paulsen IT, Press CM, Ravel J, Kobayashi DY, Myers GSA, Mavrodi DV, DeBoy RT, Seshadri R, Ren Q, Madupu R, ve diğerleri: Bitki kommensalinin tam genom dizisi Pseudomonas floresan Pf-5. Nat Biyoteknoloji. 2005, 23: 873-10.1038/nbt1110.

Mongodin EF, Hance IR, Deboy RT, Gill SR, Daugherty S, Huber R, Fraser CM, Stetter K, Nelson KE: Gen transferi ve genom plastisitesi Termotoga maritima, bir model hipertermofilik tür. J Bakteriyol. 2005, 187: 4935-4944. 10.1128/JB.187.14.4935-4944.2005.

Nesbø CL, Nelson KE, Doolittle WF: Baskılayıcı çıkarmalı hibridizasyon, geniş genomik çeşitliliği tespit ediyor Termotoga maritima. J Bakteriyol. 2002, 184: 4475-4488. 10.1128/JB.184.16.4475-4488.2002.

Tettelin H, Masignani V, Cieslewicz MJ, Donati C, Medini D, Ward NL, Angiuoli SV, Crabtree J, Jones AL, Durkin AS, ve diğerleri: streptokok agalactiae: mikrobiyal "pan-genom" için çıkarımlar. Proc Natl Acad Sci ABD. 2005, 102: 13950-13955. 10.1073/pnas.0506758102.

Hao W, Golding GB: Bakteriyel gen hareketi paternleri. Mol Biol Evol. 2004, 21: 1294-1307. 10.1093/molbev/msh129.

Ortutay C, Gaspari Z, Toth G, Jager E, Vida G, Orosz L, Vellai T: Türleşme klamidya: genom çapında filogenetik analizler, güvenilir bir edinilmiş gen seti tanımladı. J Mol Evol. 2003, 57: 672-680. 10.1007/s00239-003-2517-3.

Daubin V, Lerat E, Perriere G: Bakteri genomlarında yanal olarak aktarılan genlerin kaynağı. Genom Biol. 2003, 4: R57-10.1186/gb-2003-4-9-r57.

Hao W, Golding GB: Yanal olarak aktarılan genlerin kaderi: hızlı şeritte adaptasyon veya ölüme giden yaşam. Genom Araş. 2006, 16: 636-643. 10.1101/gr.4746406.

Marri PR, Bannantine JP, Paustian ML, Golding GB: Yanal gen transferi mikobakteriyum avium alt türler paratüberküloz. Can J Mikrobiol. 2006, 52: 560-569. 10.1139/W06-001.

Kunin V, Ouzounis CA: Prokaryotlarda genom evrimi sırasında itici güçlerin dengesi. Genom Araş. 2003, 13: 1589-1594. 10.1101/gr.1092603.

Mirkin BG, Fenner TI, Galperin MY, Koonin EV: Prokaryotların evriminde yatay gen transferinin son evrensel ortak atası ve hakimiyeti olan genom evrimi için cimri evrim senaryolarını hesaplamak için algoritmalar. BMC Evol Biol. 2003, 3: 2-10.1186/1471-2148-3-2.

McLysaght A, Baldi PF, Gaut BS: Poxvirüslerin adaptif evrimi ile ilişkili kapsamlı gen kazanımı. Proc Natl Acad Sci ABD. 2003, 100: 15655-15660. 10.1073/pnas.2136653100.

Mira A, Ochman H, Moran NA: Silinme yanlılığı ve bakteri genomlarının evrimi. Trendler Genet. 2001, 17: 589-596. 10.1016/S0168-9525(01)02447-7.

Ochman H, Davalos LM: Bakteri genomlarının doğası ve dinamikleri. Bilim. 2006, 311: 1730-1733. 10.1126/bilim.1119966.

Lerat E, Ochman H: Bakteri genomlarındaki psödojenleri tanımak. Nükleik Asitler Araş. 2005, 33: 3125-3132. 10.1093/nar/gki631.

Liu Y, Harrison PM, Kunin V, Gerstein M: Prokaryotlarda psödojenlerin kapsamlı analizi: yaygın gen bozulması ve varsayılan yatay olarak aktarılan genlerin başarısızlığı. Genom Biol. 2004, 5: R64-10.1186/gb-2004-5-9-r64.

Andersson JO, Andersson SG: Pseudogenes, hurda DNA ve dinamikleri riketsiya genomlar. Mol Biol Evol. 2001, 18: 829-839.

Feil EJ: Küçük değişiklik: mikro evrime ayak uydurmak. Nat Rev Mikrobiyol. 2004, 2: 483-495. 10.1038/nrmicro904.

Altschul SF, Madden TL, Schaffer AA, Zhang J, Zhang Z, Miller W, Lipman DJ: Gapped BLAST ve PSI-BLAST: yeni nesil protein veritabanı arama programları. Nükleik Asitler Araş. 1997, 25: 3389-3402. 10.1093/nar/25.17.3389.

Hanage W, Fraser C, Spratt B: Rekombinojenik bakteriler arasında bulanık türler. BMC Biol. 2005, 3: 6-10.1186/1741-7007-3-6.

Thompson JD, Higgins DG, Gibson TJ: CLUSTAL W: sıra ağırlıklandırma, pozisyona özgü boşluk cezaları ve ağırlık matrisi seçimi yoluyla aşamalı çoklu sıra hizalamasının hassasiyetini iyileştirme. Nükleik Asitler Araş. 1994, 22: 4673-4680. 10.1093/nar/22.2.4673.

Swofford D: PAUP* 4.0 Beta Sürümü, Parsimony (ve Diğer Yöntemler) Kullanılarak Filogenetik Analiz. 1998, Sunderland, MA Sinauer Associates

van Dongen S: Grafikler için bir küme algoritması. Teknik Rapor INS-R0010. 2000, Amsterdam: Hollanda'da Ulusal Matematik ve Bilgisayar Bilimleri Araştırma Enstitüsü

Konstantinidis KT, Tiedje JM: Prokaryotlar için tür tanımını geliştiren genomik anlayışlar. Proc Natl Acad Sci ABD. 2005, 102: 2567-2572. 10.1073/pnas.0409727102.

Pearson WR: Etkili protein dizisi karşılaştırması. Yöntemler Enzimol. 1996, 266: 227-258.

Fraser-Liggett CM: Mikrobiyal genom dizilemesinden biyoloji ve evrim üzerine içgörüler. Genom Araş. 2005, 15: 1603-1610. 10.1101/gr.3724205.

Nierman WC, DeShazer D, Kim HS, Tettelin H, Nelson KE, Feldblyum T, Ulrich RL, Ronning CM, Brinkac LM, Daugherty SC, ve diğerleri: Yapısal esneklik Burkholderia mallei genetik şifre. Proc Natl Acad Sci ABD. 2004, 101: 14246-14251. 10.1073/pnas.0403306101.


Rekombinasyon: Tanımı, Mekanizması ve Türleri | Mikrobiyoloji

Bu yazıda şunları tartışacağız: - 1. Rekombinasyonun Tanımı 2. Rekombinasyonun Mekanizması 3. Tipleri.

Rekombinasyonun Tanımı:

Organizmaların en önemli özellikleri çevreye uyum sağlamaları ve DNA dizilerini hücrelerde nesiller boyu çok az değişiklikle korumalarıdır. Organizmaların uzun vadede hayatta kalması, organizmanın zamanla değişen bir çevreye uyum sağlayabilmesi için anahtar bir özellik olan genetik varyasyonlara bağlıdır.

Organizmalar arasındaki bu değişkenlik, DNA'nın gen kombinasyonunda küçük bir değişiklikle sonuçlanan genetik yeniden düzenlemelere girme yeteneği ile ortaya çıkar. DNA'nın yeniden düzenlenmesi, genetik rekombinasyon yoluyla gerçekleşir.

Böylece rekombinasyon, iki organizmadan gelen genetik materyali birleştirerek yeni rekombinant kromozom oluşturma sürecidir. Yeni rekombinantlar fenotipik karakterlerde değişiklikler gösteriyor.

Ökaryotların çoğu, rekombinasyon yoluyla yeni alelik kombinasyonlar oluşturan önemli bir olay olan mayoz bölünme de dahil olmak üzere tam bir cinsel yaşam döngüsü gösterir. Aynı gen dizilerini içeren iki homolog kromozom arasında çapraz geçişten kaynaklanan kromozomal değişim yoluyla mümkün olur.

Klasik genetiğin temellerini atan 1945 yılına kadar ökaryotik genetik üzerine pek çok çalışma yapıldı. Bakteri genetiği üzerine yapılan çalışmalar 1945 ve 1965 yılları arasında moleküler düzeyde mikrobiyal genetiğin anlaşılmasını ilerletti.

Rekombinasyon Mekanizması:

Temel olarak, rekombinasyon mekanizmasını açıklayan üç teori, yani kırılma ve yeniden birleşme, kırılma ve kopyalama ve tam kopya seçimi vardır (Fig.8.23).

(i) Kırılma ve Yeniden Birleşme:

Gen lokusları a ve b ile a + ve b + arasında eşleştirilmiş biçimde uzanan iki homolog kromozom dupleks (Şekil 8.23A). Kırık parçalar çapraz olarak yeniden birleşir ve a ve b + segmenti ve a + ve b segmenti içeren rekombinantlar verir. Bu tür rekombinasyon, yeni DNA sentezini gerektirmez. Bu kavram, genetik rekombinasyonu açıklamak için kullanılmıştır.

(ii) Kırılma ve Kopyalama:

Bir eşleştirilmiş homolog kromozom sarmalı (ab ve a + b + ) a ve b arasında kırılır (Şekil 8.23B). Segment b, b + 'dan kopyalanan ve bir bölüme eklenen yeni sentezlenmiş bir segment ile değiştirilir. Böylece rekombinantlar ve ab + ve a + b + içerir.

(iii) Komple Kopya Seçimi:

1931'de Belling, daha yüksek hayvanlarda kromozomun rekombinasyonu için bu teoriyi önerdi. Ancak, birkaç işçi tarafından sorgulandı. Bu nedenle, sadece tarihi öneme sahiptir.

Bu teoriye göre, bir ebeveyn homolog kromozom dizisinin bir kısmı, DNA molekülünün bir kopyasının sentezi için şablon görevi görür. Kopyalama işlemi diğer ebeveyn dizisine geçer. Bu nedenle rekombinantlar, bir ebeveyn zincirinin ve diğer zincirin bir kısmının bazı genetik bilgilerini içerir (Şekil 8.23 ​​C).

Rekombinasyon Türleri:

Mikroorganizmalarda birçok türde rekombinasyon meydana gelir.

Bunlar temel olarak aşağıdaki üç gruba ayrılır:

(ii) Karşılıklı olmayan rekombinasyon ve

(iii) Siteye özel rekombinasyon.

(i) Genel Rekombinasyon:

Genel rekombinasyon, yalnızca iki homolog DNA molekülünün tamamlayıcı zincirleri arasında meydana gelir. Smith (1989), prokaryotlardaki homolog rekombinasyonu gözden geçirdi. E. coli'deki genel rekombinasyon, iki homolog DNA molekülünün tamamlayıcı zincirleri arasındaki baz eşleştirme etkileşimleri tarafından yönlendirilir.

İki DNA molekülünün çift sarmalı kırılır ve iki kırık uç, çift sarmal oluşturmak üzere yeniden birleşmek üzere karşıt ortaklarıyla birleşir. Değişim bölgesi, bir DNA molekülünün bir ipliğinin, iki çift sarmal arasında heterodubleks elde etmek için ikinci iplikle baz çifti haline geldiği homolog nükleotid dizisinde herhangi bir yerde meydana gelebilir (Şekil 8.24).

Heterodublekste, bölünme ve yeniden birleşme olayları nedeniyle değişim bölgesinde hiçbir nükleotit dizisi değişmez. Bununla birlikte, heterodubleks eklemler az sayıda uyumsuz baz çiftine sahip olabilir.

Genel rekombinasyon, homolog kromozomlar gerektirdiği için homolog rekombinasyon olarak da bilinir. Bakteri ve virüslerde genel rekombinasyon, RecA proteini gibi rec genlerinin ürünleri tarafından gerçekleştirilir. RecA proteini DNA onarımı için çok önemlidir, bu nedenle recA'ya bağımlı rekombinasyondur.

Genel Rekombinasyon için Holliday Modeli:

Holliday (1974), genel rekombinasyonu göstermek için bir model sundu (Şekil 8.25). Bu modele göre rekombinasyon, iplik kopması, iplik eşleşmesi, iplik istilası/asimilasyonu, kiazma (crossing over) oluşumu, kırılma ve yeniden birleşme ve uyumsuzluk onarımı gibi beş adımda gerçekleşir.

Şekil 8.25 : Karşılıklı genel rekombinasyon için Holliday modeli.

Genel rekombinasyon, DNA dupleksinin (a) tamamlayıcı tek dizileri arasında çiftleşme yoluyla çaprazlama yoluyla gerçekleşir. DNA çift sarmalının iki homolog bölgesi bir değişim reaksiyonuna girer.

Homolog bölge, bir veya iki orijinal çift sarmaldan bir iplik ve diğerinden tamamlayıcı bir iplik arasında uzun bir tamamlayıcı baz eşleşmesi dizisi içerir. Ancak DNA'nın homolog bölgesinin birbirini nasıl tanıdığı bilinmiyor.

Rekombinasyon genlerinin bir listesi ve işlevleri Tablo 8.2'de verilmiştir. E. coli'de rekombinasyon için recBCD veya recJ genlerinin RecBCD proteinleri gereklidir. Bu protein DNA'ya çift sarmalın bir ucundan girer ve DNA boyunca saniyede yaklaşık 300 nükleotid hızında çift sarmalda hareket eder.

Seyahat eden DNA (b) boyunca bir ssDNA döngüsü oluşturur. ATP moleküllerinin hidrolizinden elde edilen enerjiyi kullanır. E. coli kromozomu (b) boyunca dağılmış sekiz nükleotitten oluşan özel bir tanıma bölgesi (a) dizisi, RecBCD proteini tarafından oluşturulan DNA'nın gezici döngüsünde çentiklenir.

Tablo 8.2 : Rekombinasyon (rec) genleri ve işlevleri.

(B) Tel eşleştirme:

RecBCD proteinleri DNA sarmalı gibi davranır çünkü bunlar ATP'yi hidrolize eder ve DNA sarmalı boyunca hareket eder. Böylece, RecBCD proteinleri, sarmaldan (c) yer değiştiren tanıma bölgesinde tek iplikli bıyık oluşumu ile sonuçlanır. Bu, DNA çift sarmalının iki tamamlayıcı dizisi arasında bir baz eşleştirme etkileşimini başlatır.

(C) Tel istilası/asimilasyon:

Bir DNA çift sarmalından üretilen tek bir iplik (bıyık), diğer bir çift sarmalı (d) istila eder. E. coli'de recA geni, tek iplikli bağlayıcı (SSB) proteinler gibi kromozomlar arasındaki rekombinasyon için önemli olan RecA proteinini üretir. RecA proteini, bir nükleoprotein filamenti oluşturmak için tek iplikli DNA'ya sıkıca bağlanır.

Roca ve Cox (1990), RecA proteininin yapısını ve işlevini gözden geçirmiştir. RecA proteini, süreçte tamamlayıcı ssDNA hidrolize eden ATP'nin hızlı renatürasyonunu destekler. RecA proteininin birkaç bağlanma yeri vardır, bu nedenle bir ssDNA'yı ve ardından bir dsDNA'yı bağlayabilir. RecA proteini önce ssDNA'ya bağlanır, ardından donör iplik ile alıcı molekül arasında homoloji arar.

Bu bölgelerin varlığından dolayı RecA proteini, ssDNA'nın homolog bölgesi ile bir DNA çift sarmalı arasında çok aşamalı bir reaksiyonu (sinapsis olarak adlandırılır) katalize eder. E. coli SSB proteini, Rec proteininin bu reaksiyonları gerçekleştirmesine yardımcı olur. Bir homoloji bölgesi, tamamlayıcı diziler arasında bir ilk baz eşleşmesi ile tanımlandığında, sinapstaki çok önemli adım meydana gelir.

İn vivo deneyler, RecA proteini ile kaplanmış bir ssDNA ile bir dsDNA sarmalı arasında çeşitli tipte komplekslerin oluştuğunu göstermiştir. İlk olarak, bir homolog bölge bulunduğunda üç iplikli bir yapıya (ssDNA, dsDNA ve RecA proteini) dönüştürülen baz olmayan bir çiftli kompleks oluşturulur.

Bu kompleks kararsızdır ve orijinal sarmaldan bir DNA heterodubleks artı yer değiştirmiş bir ssDNA üretir. Homolog bölgelerle karşılaşıldığında ve ssDNA ve dsDNA kompleksleştirildiğinde, kararlı bir D-döngüsü oluşur (d).

Bir sonraki adım, iplik ve çentik ligasyonunun (e) asimilasyonudur. Donör iplik, dal göçü olarak adlandırılan alıcı ipliği kademeli olarak değiştirir. Sinaps oluşumundan sonra, heterodubleks bölge, RecA proteini tarafından katalize edilen protein yönelimli dal göçü yoluyla genişletilir.

RecA proteinine yönelik dal göçü, ssDNA üzerindeki RecA protein filamentinin bir ucuna daha fazla RecA proteininin eklenmesi nedeniyle bir yönde tek tip bir oranda ilerler. Dal göçü, diziye sahip iki tek ipliğin aynı tamamlayıcı iplikle eşleşmeye çalıştığı herhangi bir noktada gerçekleşebilir.

Toplam DNA baz çifti sayısını değiştirmeden dal noktasının hareketine neden olan diğer tek ipliğin eşleşmemiş bir bölgesi. Protein yönlendirmeli dal göçünü katalize eden özel DNA helikazları rekombinasyonda yer alır. Buna karşılık, kendiliğinden dal göçü her iki yönde de hemen hemen aynı oranda ilerler. Bu nedenle, uzun bir mesafede biraz ilerleme kaydeder.

(e) Chiazma veya geçiş formasyonu:

İki çift sarmal arasında tek bir ipliğin değişimi, genel bir rekombinasyon olayında farklı bir adımdır. İlk çapraz iplik değişiminden sonra, birbirine yakın iki sarmal arasındaki diğer iplik değişimlerinin hızla ilerlediği düşünülmektedir. Bir nükleaz, bazı noktalarda D-döngüsünü parçalar ve kısmen bozar.

Bu aşamada muhtemelen farklı organizmalar farklı yollar izler. Bununla birlikte, çoğu durumda çapraz iplik değişimi adı verilen önemli bir yapı (Holiday Juncture veya chi formu veya chiasmalar olarak da adlandırılır, katılan iki DNA sarmalı (g) tarafından oluşturulur. Dressier ve Potter (1982) tarafından elektron mikroskobu altında da gözlemlenmiştir.

Başlangıçta bir sarmalın (g) her birinden bir sarmalın kaynaklandığı dört zincirden ikisinin karşılıklı değişimi ile eşlenen ve bir arada tutulan iki homolog sarmalın chi formu.

Chi formunun iki önemli özelliği vardır, (i) değişim noktası çift dal göçü ile sarmallar boyunca hızla ileri geri hareket edebilir ve (ii) iki çift zincir, bir çift çapraz şerit ve diğer çift içerir. çapraz olmayan ipliklerden.

(f) Kırılma ve birleşme:

Chi yapısı birkaç dönüşü (h) izomerize edebilir. Bu, iki orijinal çapraz olmayan şeridin çapraz şeritlere ve çapraz şeritlerin çapraz olmayan şeritlere dönüştürülmesiyle sonuçlanır. İki ayrı DNA sarmalını yeniden oluşturmak için, iki çapraz iplikte kırılma ve yeniden birleşme gereklidir.

İzomerizasyondan önce kırılma ve yeniden birleşme meydana gelirse, iki kesişen iplik oluşmayacaktır. Bu nedenle, genel genetik rekombinasyondan kaynaklanan iki homolog DNA çift sarmalının kırılması ve yeniden birleşmesi için izomerizasyon gereklidir.

Kırılma ve birleşme ya dikey ya da yatay düzlemde gerçekleşir. Kırılma yatay olarak gerçekleşirse, rekombinantlar, iç bölgede (i) baz dizilerinde küçük bir değişiklikle ABlab genotipini içerecektir.

Bununla birlikte, kırılma dikey olarak meydana gelirse, rekombinantlar Ab/aB (J) içerecektir. Sırasıyla ruvC ve recG genlerinden ifade edilen RurC proteini ve RecG proteininin, Holliday yapısına özgü alternatif endonükleazlar olduğu düşünülmektedir.

(g) Uyuşmazlık Onarımı (Uyumsuzluk Korumalı Okuma ve Uzatma Sistemi):

Rekombinasyondan sonra eşleşmeyen eşleşmeyen baz çiftlerini düzelten böyle bir onarım sistemidir. Bu sistem, DNA polimerazın yanlış&uyumsuz fonksiyonunu tanır. Mekanizma, yaklaşık 3.000 nükleotid ile birlikte diğer uyumsuz bazlardan birinin kesilmesini içerir. This RecFJO is involved in the repair of short mismatch either in the initial stage or at the end of recombination.

The two proteins MutS and MutL are present in bacteria and eukaryotes. The MutS protein binds to mismatched base pair, whereas MutL scan the DNA for a nick (Fig. 8.26).

When a nick is formed MutL triggers the degradation of the nicked strand all the way back through the mismatch, because the nicks are largely confined to the newly replicated strands in eukaryotes, replication errors are selectively removed. In bacteria the mechanism is the same except that an additional protein MutH nicks the un-methylated GATC sequences and begins the process.

It has been demonstrated in yeast and bacteria that the same mismatch repair system which removes replication errors as in Fig. 8.26 also interrupts the genetic recombination events between imperfectly matched DNA sequences. It is known that homologous genes in two closely related bacteria (E. coli and S.typhimurium) generally will not recombine, even after having 80% identical nucleotide sequences.

However, when mismatch repair system is inactivated by mutation, the frequency of such interspecies recombination increases by 100-fold. This mechanism protects the bacterial genome from sequence changes that would be caused by recombination with foreign DNA molecules entering in the cell.

(ii) Non-reciprocal Recombination (Gene Conversion):

The fundamental law of genetics is that the two partners contribute the equal amount of genes to the offsprings. It means that the offsprings inherit the half complete set of genes from the male and half from the female. One diploid cell undergoes meiosis producing four haploid cells therefore, the number of genes contributed by male gets halved and so the genes of female.

In higher animals like man it is not possible to analyse these genes taking a single cell. However, in certain organisms such as fungi it is possible to recover and analyse all the four daughter cells produced from a single cell through meiosis.

Occasionally, three copies of maternal allele and only one copy of paternal allele is formed by meiosis. This indicates that one of two copies of parental alleles has been altered to the maternal allele. This gene alteration is of non-reciprocal type and is called gene conversion. Gene conversion is thought to be an important event in the evolution of certain genes and occurs as a result of the mechanism of general recombination and DNA repair.

Non-reciprocal general recombination is given in Fig. 8.27. Kobayashi (1992) has discussed the mechanism for gene conversion and homologous recombination.

This process starts when a nick is made in one of the strands (a). From this point DNA polymerase synthesizes an extra copy of a strand and displaces the original copy as a single strand (b). This single strand starts pairing with the homologous region as in lower duplex of DNA molecule (b). The short unpaired strand produced in step (b) is degraded when the transfer of nucleotide sequence is completed. The results are observed (in the next cycle) when DNA replication has separated the two non-matching strands (c).

(iii) Site-Specific Recombination:

Site specific recombination alters the relative position of nucleotide sequences in chromosome. The base pairing reaction depends on protein mediated recognition of the two DNA sequences that will combine. Very long homologous sequence is not required.

Unlike general recombination, site specific recombination is guided by a recombination enzyme that recognises specific nucleotide sequences present on one of both recombining DNA molecules. Base pairing is not involved, however, if occurs the heteroduplex joint is only a few base pair long.

It was first discovered in phage λ by which its genome moves into and out of the E. coli chromosome. After penetration phage encoded an enzyme, lambda integrase which catalyses the recombination process (Fig. 8.28). Lambda integrase binds to a specific attachment site of DNA sequence on each chromosome.

It makes cuts and breaks a short homologous DNA sequences. The integrase switches the partner strands and rejoins them to form a heteroduplex joint of 7 bp long. The integrase resembles a DNA topoisomerase in rejoining the strands which have previously been broken.

Site specific recombination is of the following two types:

(a) Conservative site-specific recombina­tion:

Production of a very short heteroduplex by requiring some DNA sequence that is the same on the two DNA molecules is known as conservative site-specific recombination. The detail procedure is described in Fig. 8.28.

(b) Trans-positional site-specific recombi­nation:

There is another type of recombination system known as trans-positional site-specific (TSS) recombination. The TSS recombination does not produce heteroduplex and requires no specific sequences on the largest DNA.

There are several mobile DNA sequences including many viruses and transposable elements that encode integrates. The enzyme integrates by involving a mechanism different from phage λ insert its DNA into a chromosome. Each enzyme of integrates recog­nises a specific DNA sequence like phage λ.

K. Mizuuchi (1992a) reviewed the mecha­nism of trans-positional recombination based on the studies of bacteriophage Mu and the other elements. The enzyme integrase was first purified from Mu. Similar to integrase of phage λ, the Mu integrase also carries out of its cutting and rejoining reactions without requirement of ATP. Also they do not require a specific DNA sequence in the target chromosome and do not form a joint of heteroduplex.

Different steps of TSS recombinational events are shown in Fig. 8.29. The integrase makes a cut in one strand at each end of the viral DNA sequences, and exposes the 3′-OH group that protrudes out. Therefore, each of these 3′-OH ends directly invades a phosphodiester bond on opposite strands of a randomly selected site on a target chromosome.

This facilitates to insert the viral DNA sequence into the target chromosome, leaving two short single stranded gaps on each side of recombinational DNA molecule.

These gaps are filled in later on by DNA repair process (i.e. DNA polymerase) to complete the recombination process. This mechanism results in formation of short duplication (short repeats of about 3 to 12 nucleotide long) of the adjacent target DNA sequence. Formation of short repeats is the hall-marks of a TSS recombination.

Fig. 8.29 : Mechanism of trans-positional site-specific recombination SDR, short direct repeats of target DNA sequence.


A Family Consents to a Medical Gift, 62 Years Later

Henrietta Lacks was only 31 when she died of cervical cancer in 1951 in a Baltimore hospital. Not long before her death, doctors removed some of her tumor cells. They later discovered that the cells could thrive in a lab, a feat no human cells had achieved before.

Soon the cells, called HeLa cells, were being shipped from Baltimore around the world. In the 62 years since — twice as long as Ms. Lacks’s own life — her cells have been the subject of more than 74,000 studies, many of which have yielded profound insights into cell biology, vaccines, in vitro fertilization and cancer.

But Henrietta Lacks, who was poor, black and uneducated, never consented to her cells’ being studied. For 62 years, her family has been left out of the decision-making about that research. Now, over the past four months, the National Institutes of Health has come to an agreement with the Lacks family to grant them some control over how Henrietta Lacks’s genome is used.

“In 20 years at N.I.H., I can’t remember something like this,” Dr. Francis S. Collins, the institute’s director, said in an interview.

The agreement, which does not provide the family with the right to potential earnings from future research on Ms. Lacks’s genome, was prompted by two projects to sequence the genome of HeLa cells, the second of which was published Wednesday in the journal Nature.

Though the agreement, which was announced Wednesday, is a milestone in the saga of Ms. Lacks, it also draws attention to a lack of policies to balance the benefits of studying genomes with the risks to the privacy of people whose genomes are studied — as well as their relatives.

As the journalist Rebecca Skloot recounted in her 2010 best-seller, “The Immortal Life of Henrietta Lacks,” it was not until 1973, when a scientist called to ask for blood samples to study the genes her children had inherited from her, that Ms. Lacks’s family learned that their mother’s cells were, in effect, scattered across the planet.

Some members of the family tried to find more information. Some wanted a portion of the profits that companies were earning from research on HeLa cells. They were largely ignored for years.

resim

Ms. Lacks is survived by children, grandchildren and great-grandchildren, many still living in or around Baltimore.

And this March they experienced an intense feeling of déjà vu.

Scientists at the European Molecular Biology Laboratory published the genome of a line of HeLa cells, making it publicly available for downloading. Another study, sponsored by the National Institutes of Health at the University of Washington, was about to be published in Nature. The Lacks family was made aware of neither project.

“I said, ‘No, this is not right,’ ” Jeri Lacks Whye, one of Henrietta Lacks’s grandchildren, said in an interview. “They should not have this up unless they have consent from the family.”

Officials at the National Institutes of Health now acknowledge that they should have contacted the Lacks family when researchers first applied for a grant to sequence the HeLa genome. They belatedly addressed the problem after the family raised its objections.

The European researchers took down their public data, and the publication of the University of Washington paper was stopped. Dr. Collins and Kathy L. Hudson, the National Institutes of Health deputy director for science, outreach and policy, made three trips to Baltimore to meet with the Lacks family to discuss the research and what to do about it.

“The biggest concern was privacy — what information was actually going to be out there about our grandmother, and what information they can obtain from her sequencing that will tell them about her children and grandchildren and going down the line,” Ms. Lacks Whye said.

The Lacks family and the N.I.H. settled on an agreement: the data from both studies should be stored in the institutes’ database of genotypes and phenotypes. Researchers who want to use the data can apply for access and will have to submit annual reports about their research. A so-called HeLa Genome Data Access working group at the N.I.H. will review the applications. Two members of the Lacks family will be members. The agreement does not provide the Lacks family with proceeds from any commercial products that may be developed from research on the HeLa genome.

With this agreement in place, the University of Washington researchers were then able to publish their results. Their analysis goes beyond the European study in several ways. Most important, they show precisely where each gene is situated in HeLa DNA.

A human genome is actually two genomes, each passed down from a parent. The two versions of a gene may be identical, or they may carry genetic variations setting them apart.

“If you think of the variations as beads on a string, you really have two strings,” said Dr. Jay Shendure, who led the Washington genome study. “The way we sequence genomes today, for the most part we just get a list of where the genes are located, but no information about which ones are on which string.”

Dr. Shendure and his colleagues have developed new methods that allow them to gather that information. By reconstructing both strings of the HeLa genome, they could better understand how Ms. Lacks’s healthy cells had been transformed over the past 60 years.

For example, they could see how Ms. Lacks got cancer. Cervical cancer is caused by human papillomavirus infections. The virus accelerates the growth of infected cells, which may go on to become tumors.

Dr. Shendure and his colleagues discovered the DNA of a human papillomavirus embedded in Ms. Lacks’s genome. By landing at a particular spot, Ms. Lacks’s virus may have given her cancer cells their remarkable endurance.

“That’s one of the frequent questions that I and the Lacks family get whenever we talk about this stuff,” Ms. Skloot said. “The answer was always, ‘We don’t know.’ Now, there’s at least somewhat of an answer: because it happened to land right there.”

Richard Sharp, the director of biomedical ethics at the Mayo Clinic, said he thought the agreement “was pretty well handled.” But he warned that it was only a “one-off solution,” rather than a broad policy to address the tension between genome research and the privacy of relatives, now that recent research has demonstrated that it is possible to reveal a person’s identity through sequencing.

Dr. Sharp considered it impractical to set up a working group of scientists and relatives for every genome with these issues. “There’s absolutely a need for a new policy,” he said.

Eric S. Lander, the founding director of the Broad Institute, a science research center at Harvard and M.I.T., said resolving these issues was crucial to taking advantage of the knowledge hidden in our genomes.

“If we are going to solve cancer, it’s going to take a movement of tens of thousands, or hundreds of thousands, of patients willing to contribute information from their cancer genomes towards a common good,” Dr. Lander said. “We are going to need to have ways to have patients feel comfortable doing that. We can’t do it without a foundation of respect and trust.”


Videoyu izle: AYT Biyoloji. Böbrek Üstü Bezi ve Eşeysel Bezler #sayfa36 (Haziran 2022).