Bilgi

Aynı uyumsuzluk grubundan plazmitlerin birlikte dönüşümü

Aynı uyumsuzluk grubundan plazmitlerin birlikte dönüşümü



We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

Aynı replikasyon orijinli (örneğin pBR322 ori) ve dolayısıyla aynı uyumsuzluk grubundan iki plazmit, E. coli'de başarılı bir şekilde birlikte transforme edilebilir mi? İki plazmitin birlikte var olmasını engelleyen mekanizmalar nelerdir? Çift direnç seçiminin ne olduğu önemli mi? Birlikte dönüşümün verimliliği, bir tek dönüşümün verimliliğiyle nasıl karşılaştırılır?


Birden çok uyumsuz plazmitin bir arada var olmasını önleyecek özel bir mekanizma olmadığı ortaya çıktı. Velappan ve arkadaşları, içlerinde farklı seleksiyon genleri olan birden fazla uyumsuz plazmit koydular ve bakterileri tek bir antibiyotiğe koydular ve ikinci vektör için periyodik olarak kontrol ettiler (ikinci antibiyotik direncini test ederek). Görünüşe göre ikinci vektörün ortadan kalkması haftalar aldı - birçok nesil.

Daha yüksek kopya numaralı plazmitler, ikinci plazmidi kaybetmek için daha uzun sürelerle daha iyi sonuç verdi. Bunun, bakterilerin seçim olmadan ikinci plazmidi kaybetmesine neden olacak olan plazmit kaybının doğal oranı olduğu sonucuna varıyorlar. Kültürde iki antibiyotik ile birkaç ay süreceğini ve bakterileri potansiyel olarak -80C'de süresiz olarak saklayabileceğinizi hayal ediyorum. Yine de çoğu deneyde, uyumlu replikasyon kökenlerinin plazmitleri tutmak için daha tipik bir yarı ömre sahip göründüğü ek bir baş ağrısı olacaktır.

Ayrıca, çift dönüşümlerin sıklığının, genellikle takdir edilenden daha sık olduğunu belirtirler; bu, plazmit hazırlıklarından tipik bir yüksek verimli dönüşümden bazı koloniler alacağınız anlamına gelir. Bununla birlikte, bu çalışmada transformasyondan ziyade çoklu plazmitleri fajmid enfeksiyonu ile tanıttılar.


Çoklu ilaca dirençli plazmid profilleme ve uyumsuzluk gruplaması Salmonella enterika Nairobi, Kenya'da serovar Typhi izole ediyor

Plazmitler, çoklu ilaca dirençli patojenlerin ortaya çıkmasına katkıda bulunan antibiyotik direnç genlerini barındırır. Çoklu ilaca dirençli hastalarda plazmitlerin varlığını tespit ettik. Salmonella enterika serovar Typhi (S. Typhi) önceki çalışmamızdan izole edilmiş ve sonuç olarak uyumsuzluk gruplarını ve konjugasyon bulaşma olasılığını belirlemiştir. Plazmitler, çoklu ilaca dirençli 98 bitkiden ekstrakte edildi. S. Alkali lizis tekniğine dayalı Typhi izolatları. Plazmit uyumsuzluk gruplaması, FIA, FIB, FIC, HI1, HI2, I1-Iγ, L/M, N, P, W, T, A/C, K, B/'yi amplifiye etmek için 18 çift primer kullanılarak PCR replikon tiplemesi ile oluşturulmuştur. O, X, Y, F ve FIIA replikonları. Antibiyotik direnç fenotipleri eşlenik olarak aktarılmıştır. S. Typhi, plazmitlerle izole eder. Escherichia koli Plazmit içermeyen K12F suşu.

Sonuçlar

MDR'nin yaklaşık %79,6'sı S. Typhi izolatları, plazmitlerin varlığı ile ilgiliydi. Uyumsuzluk (Inc) grubu HI1'e ait plazmitlerin %93,6'sını tespit ettik. Tanımlanan diğer uyumsuzluk grupları, IncFIC (%16,7), IncP (%1.3) ve IncI1 (%1.3) olup Inc HI1 ile birlikte ortaya çıktı. MDR S. İzole edilen Typhi, çoğu ampisilin, tetrasiklin ve kloramfenikolün direnç fenotiplerini transkonjugantlara aktaran uyumsuzluk grubu HI1'in homolog bir plazmidi taşıyordu.


Tech Clinic #4: Tek bir E.coli 2 plazmit alabilir mi?

Aşağıdaki soru Beheroze Sattha tarafından Bitesize Bio'ya e-posta ile gönderildi ve ben bu meydan okumayı memnuniyetle üstlendim ve cevabı hemen biliyordum. Ya da öyle düşünmüştüm.

Pubmed, Genes V (biliyorum, yeni bir versiyona ihtiyacım var) ve Moleküler Klonlama'yı kapsamlı bir şekilde inceledikten sonra bir cevap buldum, ancak başlangıçta düşündüğüm şey bu değildi ve bu, plazmit, klonlama ve klonlama konusundaki anlayışımın bazı yönlerini değiştiriyor. kafalarındaki dönüşüm. Bu yüzden, bu benim en iyi cevabım olsa da, bu konudaki düşüncelerinizi duymak isterim.

İşte Beheroze'un sorusu:

merak ettim tek E. koli iki plazmit alabilir. SNP'leri aramak için mitokondriyal genomun bir bölümünü klonluyorum. Klonlamadan sonra ve
dizileme, bazı dizilerin karışımlar gösterdiğini fark ettim, örneğin Y veya R. E.coli biri C olan iki plazmit almıştı ve
diğer (SNP) T ile sıralandığında Y olarak görünür.

İlk tepkim, her birinin E.coli hücre yalnızca bir plazmit molekülü tarafından dönüştürülebilir, bu daha sonra yalnızca tek bir plazmit türü içeren klonal bir bakteri popülasyonu oluşturmak için çoğaltılır. Anladığım kadarıyla ortak bilgelik bu. Ama bu doğru mu? Ve eğer öyleyse, nasıl olur?

Yine, ilk akıl yürütmem, tek bir E.coli'nin tek bir transformasyonda iki plazmit molekülü tarafından transforme edilmesinin son derece nadir olduğuydu. Ama bu doğru mu? Eh, hayır değil.

Çift dönüşüm hiç de nadir değildir!

Yetkin hücre hazırlığınızda, hücrelerin yalnızca bir kısmı aslında bakterileri almaya yetkindir ve bunların bir alt popülasyonu, tek bir dönüşümde iki veya daha fazla plazmiti kolayca alabilir.

Bu, 1979'da Weston ve arkadaşları tarafından E.coli'nin CaCl2 dönüşümü için [1] ve daha yakın zamanda elektroporasyon [2] için gösterilmiştir. Weston ve arkadaşları, hücre popülasyonunun yalnızca %0.26'sının dönüştürülebilir olduğunu ve bu yetkin hücrelerin yalnızca %10-20'sinin (yani yaklaşık %0.052) olduğunu gösteren doz yanıt eğrileri (plazmid DNA konsantrasyonu - elde edilen dönüştürücü sayısı) oluşturmuştur. popülasyon iki veya daha fazla plazmit molekülü alabilir. Elektroporasyon üzerine daha yakın tarihli bir çalışmada, Goldsmith ve diğerleri, hücrelerin bir dönüşümde iki bağımsız plazmit molekülü tarafından dönüştürülmesinin mümkün olduğunu ve çift dönüşümlerin sıklığının plazmit konsantrasyonu ile katlanarak arttığını da gösterdi.

Dolayısıyla, çift transformasyon – iki (veya daha fazla) plazmit molekülünün tek bir transformasyon prosedüründe tek bir E.coli'ye girişi, o kadar da nadir değildir. Aslında Weston ve arkadaşlarının istatistiklerine göre, transformantlarınızın %20'ye kadarı çift transformant olabilir.

Peki ya aynı replikonu taşıyan plazmitler?

Ancak Beheroze'nin deneyinde, klonların aynı plazmit omurgası üzerinde farklı ekleri vardır ve hepsinin aynı replikasyon kaynağı vardır. Geleneksel bilgelik, bu plazmitlerden ikisinin bir dönüşüm sırasında tek bir E.coli'ye girmesi durumunda, plazmit uyumsuzluğunun ikisinin de yayılmayacağını belirtir.

Plazmit uyumsuzluğu, aynı hücrede birlikte bulunan iki plazmitin kalıcı olarak kalıtsal olarak aktarılamaması olarak tanımlanır. Benzer replikasyon kökenlerine sahip plazmitlerin ve dolayısıyla plazmitin replikasyonunu ve segregasyonunu düzenleyen benzer sistemlerin, aynı 'uyumsuzluk grubunda' olduğu ve her ikisinin de tutarlı bir şekilde yavru hücrelere aktarılamayacağı söylenir. Bunun nedeni, bir plazmitin kopya sayısının replikon tarafından sıkı bir şekilde düzenlenmesi ve aynı replikona sahip iki plazmide sahip olmanın, hücre bölünmesi sırasında replikasyon veya bölümleme için gerekli düzenleyici faktörleri paylaştıkları için bu düzenlemeye müdahale etmesidir. Etkili bir şekilde, iki plazmit klonu, replikasyon ve bölümleme için gerekli mevcut faktörler için rekabet eder.

Plazmid uyumsuzluğu bir çift transformantta nasıl etkili olur?

Bunu düşünmenin basit bir yolu, kopya sayısı iki olan bir plazmit hayal etmemizdir (bakınız şekil 1A). Replikasyonun kaynağının düzenleyici makinesi, kopya sayısını ikide tutacak şekilde ayarlanmıştır, ancak aynı replikasyon kaynağına sahip iki farklı plazmit klonu içeren bir çift transformantta, replikonun kopya sayısı zaten ikidir, dolayısıyla hiçbir replikasyon meydana gelmez. İki plazmit daha sonra hücre bölünmesinden sonra farklı yavru hücrelere ayrılacak, böylece her yavru hücre homojen bir plazmit popülasyonu içerecektir.

Bunların hepsi çok iyi, ancak hücreler bölünme şansları olmadan önce kaplanırsa, bu, iki farklı plazmit klonu içeren bir klonla sonuçlanabilir. Ayrıca çoğu plazmitin kopya numarası 2'den büyük olduğundan durum daha karmaşıktır. 4 kopya sayısıyla bile, heterojen bir plazmit popülasyonunu çoğaltma şansı artıyor gibi görünüyor.

Yaygın olarak anlaşılan bilgelik, iki plazmit klonunun, birinin diğerine göre daha hızlı replikasyon hızına veya artan toksisiteye sahip olmasına neden olan küçük farklılıklara sahip olacağıdır. Bunun, plazmitlerin asimetrik olarak kopyalanmasına neden olarak klonlardan birinin nihai kaybına katkıda bulunduğu söylenir.

Bu, birçok durumda görünüşte doğrudur, ancak Velappan ve arkadaşlarından [3] 2007 tarihli bir makale, aynı replikasyon kökenlerine sahip iki plazmit içeren çift transformantlarda, özellikle bir yüksek kopya numarası kökenli (pUC gibi) kullanılır.

Bunu bir dönüşümün bağlamı olarak kabul ederseniz, bana bu, Beheroze'un karışık bir plazmit popülasyonu içeren bir koloni elde etmesi tamamen mümkün gibi görünüyor. Bu, tek bir E.coli'nin dönüşüm sırasında iki farklı klonu almasından ve koloni büyüdükçe aynı hücrelerde veya ayrı popülasyonlarda (veya her ikisinde) çoğaltılmasından kaynaklanmış olabilir.

Çift transformantlardan nasıl kaçınılabilir?

Bundan, karışık bir plazmit popülasyonunun dönüştürüldüğü ve homojen bir klonlamanın istendiği herhangi bir deneyde, çift dönüşümler akılda tutulmalı, teşhis edilmeli ve mümkünse bundan kaçınılmalıdır.

1. Düşük konsantrasyonlarda plazmit kullanın. Goldsmith ve diğerleri, çift dönüşümün plazmit konsantrasyonu ile katlanarak arttığını gösterdi, bu nedenle, deneyinizin kısıtlamaları göz önüne alındığında, plazmit konsantrasyonunu mümkün olduğunca düşük tutmanız yardımcı olacaktır.

2. Koloni PCR veya dizileme kullanarak klonları kontrol edin. PCR, pozitif ve negatif klonlar için farklı bantlar verecekse, koloni PCR özellikle iyi çalışacaktır.
Çift transformantınız varsa, iki bant verecektir. Beheroze, ortaya çıkan plazmit hazırlıklarını sıralayarak ve şunu fark ederek çift klonları tanımladı.
karışım iki farklı dizi içerebilir.

3. Birden fazla klon seçin. Bazı çift transformantlarınız varsa, bir pozitif klon bankası seçerseniz, bunlar azınlıkta olmalıdır. Tek başına dönüştürülmüş pozitifler, koloni PCR veya dizileme ile kolayca tanımlanmalıdır.

4. Çok sayıda pozitif klonunuz yoksa yeniden izole edin. Pozitif klonlar izole edilmeli ve taze bir kültürü aşılamak için kullanılmalı, bir agar plakasına düşük yoğunlukta ekilmeli ve tek tek koloniler yeniden analiz edilmelidir. Orijinal klon, çift transformasyon veya çok yüksek yoğunlukta kaplama nedeniyle farklı plazmitler içeren iki hücre tipinin karışık bir popülasyonundan oluşuyorsa, bu, ikisini çözecektir (bu, Beheroze'nin sonucunun diğer olası açıklamasıdır). Alternatif olarak, plazmit(ler)i pozitif klondan izole edebilir ve yeniden dönüştürebilirsiniz. Plazmit popülasyonunuz karıştırılmışsa, orijinal olarak birlikte transforme edilmiş plazmitlerden birini veya diğerini içeren (çoğunlukla) tekli transformantlardan oluşan bir plaka alacaksınız.

Bunun benim için gerçek bir ufuk açıcı olduğunu söylemeliyim, ancak yakınımda tuttuğum bir algıyı hiçbir kanıt olmadan tanımlayabildiğimde ve onu aydınlatmak için uğraştığımda hoşuma gidiyor. Ancak, burada bir şeyleri kaçırıyor olabilirim, bu yüzden daha fazla aydınlatma sağlayabilirseniz veya herhangi bir sorunuz varsa, lütfen yorum bırakmaktan çekinmeyin.

1. Weston A, ve diğerleri Escherichia coli'nin Uyumlu ve Uyumsuz Plazmit DNA Molekül Çiftleri tarafından eşzamanlı transformasyonu. Mol Gen Genetiği (1979) 172 s113


İki plazmidi olan bakterilerden protein ekspresyonu? - Plazmitlerin uyumsuzluğu (27 Temmuz/2007 )

Merhaba!
Bakterilerde iki plazmit ifade etmeyi planlıyorum. F1 kökenli iki farklı pET vektörüm olacak. Farklı antibiyotik dirençleri vardır. İki pET vektörünü ifade etme konusunda 'kötü' veya 'iyi' deneyimi olan var mı? bhttp://www.protocol-online.org/forums/style_images/1/folder_post_icons/icon2.gif dosyasında iki plazmit ifade etmenin sorunlu olabileceğini okudum.
http://www.protocol-online.org/forums/styl. con2.gifacteria, iki plazmitin uyumsuzluğundan kaynaklanır. Ancak uyumsuz sayılacak kriterler hakkında herhangi bir bilgi bulamadım.
Cevaplarınız için minnettar olurum.
Teşekkürler

gerçekten anlamıyorum. Bakteri içindeki 2 plazmidi dönüştürmekten mi bahsediyorsunuz? Hmm.. Bunu ilk defa duydum. Kendi görüşüme göre, aynı anda 2 plazmit ifade etmenin çok iyi bir fikir olacağını düşünmüyorum. 1 plazmidin kendisini ifade etmek zordur.

5 plazmit? Hmm ne tür bakteriler bunu yapabilir? Sadece merak ediyorum. Bu konuda uzman değil. =)

Her plazmit türünün kendi antibiyotik seçim belirteci olduğu için yapmak istediğiniz şey mümkündür. Bununla birlikte, aynı uyumsuzluk grubundan iki plazmit birbirinin kararlı kalıtımı ile etkileşime girdiğinden sistem kararsızdır. Böylece plazmit A'nın plazmit B'ye oranı hücreden hücreye değişecektir. bazı hücreler daha fazla plazmit A'ya sahip olacak ve diğerleri daha az olacaktır. Bu da, her plazmit tarafından ifade edilen proteinlerin oranının hücreler arasında farklılık göstermesiyle sonuçlanır.

Yaklaşık 30 uyumsuzluk grubu vardır. Yani teorik olarak sahip olabilirdim

Her plazmit farklı bir uyumsuzluk grubundan geldiği sürece yan yana yaşayan 30 plazmit.

Yine de 5 çok fazla. En çok okuduğum 4. E coli hücreleri çok mutlu değildi. Çok fazla antibiyotik.

1 E.coli içinde 2 plazmit tutabilirsiniz, ancak şunlara ihtiyacınız vardır:
- Farklı çoğaltıcı faktörleri (farklı ori)
- Farklı seçim işaretleri.

F1 kökenli 2 farklı pET vektörünüz olduğunu söylediğiniz için, her iki vektör için de ori bölgesinin aynı olduğunu varsayıyorum? Eğer öyleyse, iki plazmit uyumsuzdur ve aynı bakteride uzun süre kalamaz. Farklı ori seçin.


Nükleik asitleri radyoizotoplarla etiketleme

6.2 Plazmit Kopya Sayısını Tahmin Etme

Plazmitler – rekombinant genlerin klonlanması için kullanılan, otonom olarak kopyalanan, dairesel DNA elemanları – bir hücre içinde bir ila birkaç yüz kopya halinde bulunur. Tek bir hücre içinde bir plazmidin kaç kopyasının bulunduğunu belirlemeye yönelik bir teknikte, plazmit taşıyan suşun bir kültürü, [3H]-timin veya [3H]-timidin (ihtiyaca bağlı olarak) varlığında büyütülür. soyundan). Büyümeden log fazına kadar, hücreler toplanır ve parçalanır ve toplam DNA izole edilir. İzole edilmiş DNA'nın bir örneği, plazmidi kromozomal DNA'dan ayırmak için bir etidyum bromür-sezyum klorür gradyanında santrifüjlenir. Santrifüjlemenin ardından santrifüj tüpünün alt kısmı delinir, fraksiyonlar filtre diskleri üzerinde toplanır ve DNA, trikloroasetik asit (TCA) ve etanol ile işlenerek filtreler üzerinde çökeltilir. Filtreler kurutulur ve bir sintilasyon spektrometresinde sayılır. Kesir sayısına karşı cpm grafiği, Şekil 6.1'de gösterilen gibi bir profil üretebilir. 12 numaralı fraksiyonda ortalanmış daha küçük tepe, süper sarmal bir formda, 26 numaralı fraksiyonda ortalanmış makaslanmış kromozomal DNA'dan daha yoğun olan plazmit DNA'yı temsil eder.

Şekil 6.1. Plazmidi kromozomal DNA'dan ayıran bir etidyum bromür-sezyum klorür gradyanından toplanan fraksiyonlar. Hücreler, radyoaktif timin veya timidin varlığında büyütülür, böylece çoğalan DNA, trityum izotopu ile etiketlenir. 12. fraksiyon etrafında merkezlenen süper sarmallı plazmit DNA, 26 fraksiyonu etrafında merkezlenmiş, kırpılmış kromozomal DNA'dan daha yüksek bir yoğunlukta çökelir.

Plazmit kopya sayısı aşağıdaki ilişki kullanılarak hesaplanır:

Sorun 6.3

6000 bp'lik bir plazmitin kopya sayısını belirlemek için bir deney E. koli daha önce açıklandığı gibi gerçekleştirilir. Plazmit içeren ana fraksiyonun 25.000 cpm içerdiği bulunmuştur. Kromozomal tepe fraksiyonu 220 000 cpm içerir. Plazmit kopya numarası nedir?

Çözüm 6.3

Bu problemi çözmenin ilk adımı, plazmitin moleküler ağırlıklarını hesaplamak ve E. koli kromozom. Plazmit 6000 bp'dir. NS E. koli kromozom uzunluğu yaklaşık 4.6 milyon bp'dir. Molekül ağırlıkları 660 dalton/bp dönüşüm faktörü kullanılarak hesaplanır.

Plazmitin moleküler ağırlığı

Molekül ağırlığı E. koli kromozom

Bu değerler daha sonra kopya sayısını hesaplamak için denkleme (bu problemden önce) dahil edilebilir:


İçindekiler

Esther M. Lederberg ve Luigi L. Cavalli-Sforza, daha sonra Joshua Lederberg ile birlikte yayın yapan "F"yi [5] keşfetti. [6] Sonuçları açıklandıktan sonra, çalışmalara iki laboratuvar daha katıldı. "Bu, F'nin eşzamanlı bağımsız bir keşfi değildi (anlaşılana kadar Doğurganlık Faktörü olarak adlandırdım.) Hayes, Jacob ve daha sonra çalışmalarına devam eden Wollman'a yazdık." [7] "F"nin keşfi, William Hayes'in "cinsiyet faktörü" keşfiyle bazen karıştırılsa da, hiçbir zaman öncelik iddiasında bulunmadı. Gerçekten de, "[Hayes] F'nin gerçekten lambda olduğunu düşündü ve onu [öyle olmadığına] ikna ettiğimizde, işine başladı." [8]

F faktörlerini oluşturan en yaygın fonksiyonel segmentler şunlardır: [9]

  • OriT (Origin of Transfer): Konjugatif transferin başlangıç ​​noktasını belirleyen dizi.
  • OriV (Origin of Vegetative Replication): Plazmid-DNA'nın alıcı hücrede kopyalanacağı ile başlayan dizi.
  • tra-region (transfer genleri): F-Pilus ve DNA transfer sürecini kodlayan genler.
  • IS (Ekleme Öğeleri) bir IS2 kopyası, iki IS3 kopyası ve bir IS1000 kopyasından oluşur: sözde "bencil genler" (kendi kopyalarını farklı konumlarda birleştirebilen dizi parçaları). [10]

Bazı F plazmit genleri ve İşlevleri:

F faktörünü barındıran epizom, bağımsız bir plazmit olarak var olabilir veya bakteri hücresinin genomuna entegre olabilir. Olası durumlar için birkaç isim vardır:

  • Hfr bakterileri bakteri genomuna entegre edilmiş tüm F epizomuna sahiptir.
  • F + bakteri bakteri genomundan bağımsız bir plazmit olarak F faktörüne sahiptir. F plazmidi sadece F faktörü DNA içerir ve bakteri genomundan DNA içermez.
  • F' (F-prime) bakteri kromozomdan yanlış eksizyonla oluşturulur ve F epizomunun yerleştirildiği yerin yanında bulunan bakteri dizilerini taşıyan F plazmiti ile sonuçlanır.
  • F - bakteri F faktörü içermez ve alıcı görevi görür.

Bir F + hücresi bir F - hücresi ile konjuge olduğunda/eşleştiğinde, sonuç iki F + hücresi olur ve her ikisi de konjugasyon yoluyla plazmidi diğer F - hücrelerine iletebilir. F+ hücresi üzerindeki bir pilus, alıcı hücre ile etkileşime girerek bir çiftleşme bağlantısının oluşmasına izin verir, DNA bir iplikte çentiklenir, çözülür ve alıcıya aktarılır. [3] [9]

F-plazmit, doğurganlık inhibisyonu (Fin) sistemi ile bakterilerin cinsel işlevlerini kontrol eden bir konjugatif plazmit sınıfına aittir. Bu sistemde, trans-etkili bir faktör olan FinO ve antisens RNA'lar, FinP, aktivatör gen TraJ'nin ekspresyonunu bastırmak için birleşir. TraJ, yukarı regüle eden bir transkripsiyon faktörüdür. tra operon. NS tra operon, konjugasyon ve plazmit transferi için gerekli genleri içerir. Bu, bir F + bakterisinin her zaman bir donör hücre olarak hareket edebileceği anlamına gelir. NS finO orijinal F plazmidinin geni (E. coli K12'de) bir IS3 eklemesi ile kesintiye uğrar, bu da kurucu tra operon ifadesi. [11] [12] F + hücreleri ayrıca bakteri yüzeyinde TraS ve TraT yüzey dışlama proteinlerine sahiptir. Bu proteinler, aynı uyumsuzluk (Inc) grubuna ait plazmitleri içeren ikincil çiftleşme olaylarını önler. Böylece, her F+ bakterisi, verilen herhangi bir uyumsuzluk grubunun yalnızca tek bir plazmit tipini barındırabilir.

Hfr transferi durumunda, elde edilen transkonjugatlar nadiren Hfr'dir. Hfr/F - konjugasyonunun sonucu, yeni bir genotipe sahip bir F - suşudur. F-prime plazmitleri bir alıcı bakteri hücresine aktarıldığında, rekombinasyonda önemli hale gelebilecek donörün DNA'sının parçalarını taşırlar. Biyomühendisler, bakteriyel yapay kromozom olarak adlandırılan, yerleştirilmiş yabancı DNA'yı içerebilen F plazmitleri yarattılar.

Şimdiye kadar tarif edilen ilk DNA sarmalı, F-plazmitinde kodlanmıştır ve plazmit transferini başlatmaktan sorumludur. Başlangıçta denirdi E. koli DNA Helikaz I, ama şimdi olarak bilinir F-plazmit izi. Bir sarmal olmasının yanı sıra, 1756 amino asit (en büyüklerinden biri) E. koli) F-plazmit TraI proteini ayrıca hem spesifik hem de spesifik olmayan tek iplikli DNA bağlanmasından ve ayrıca transferin kaynağında tek iplikli DNA'nın çentiklenmesini katalize etmekten sorumludur.


Malzemeler ve yöntemler

Plazmit Koleksiyonu

Koleksiyonumuz, tüm eksiksiz plazmitleri (𠇋irleştirilmiş molekül” statüsüyle) içeriyordu. A. baumannii 14 Ağustos'ta RefSeq ve GenBank veritabanlarında (NCBI) mevcut NS , 2017. Sonraki tüm analizler için Python 2.7'de GenBank ve fasta dosyalarını SeqIO Biopython modülüyle (Cock ve diğerleri, 2009) ayrıştırdık.

Plazmit koleksiyonumuzun çeşitliliğini artırmak için, PacBio RSII ve Illumina NextSeq platformlarını kullanarak 10 Meksika izolatının tam genom dizilerini elde ettik. Üç izolatın, yani 7804, 810CP ve 3207'nin genom dizileri, bu yazının bazı yazarları tarafından daha önce rapor edilmiştir (Castro-Jaimes ve diğerleri, 2016 Pérez-Oseguera ve diğerleri, 2017).

Diğer sekiz izolat için, SPAdes v3.9.0 veya Unicycler v0.4.1 kullanarak her iki platformdan okumalar içeren hibrit düzenekler oluşturduk (Bankevich ve diğerleri, 2012 Wick ve diğerleri, 2017). NCBI Prokaryotic Genome Annotation Pipeline ile fonksiyonel açıklama yaptık. Meksika izolatlarının genomlarının GenBank erişim numaraları Ek Tablo S10'da listelenmiştir. Bu nedenle, toplamda 173 tam plazmiti analiz ettik ve plazmitlerin ve suşların tam listesi Ek Tablo S1'de gösterilmektedir.

Plazmid Lineage Sınırlandırma

Koleksiyonumuzdaki 173 tam plazmitin tümü arasında eşleştirilmiş BLASTn (Camacho ve diğerleri, 2009) aramaları gerçekleştirdik. Her biri belirli bir kapsama alanına (%40 ila %90) dayanan farklı plazmit ağları oluşturduk. Her plazmit çifti için, eğer en küçük plazmit diğer plazmitin en az tanımlanmış bir yüzdesini kapsıyorsa, plazmitler arasına bir bağlantı yerleştirdik, burada kapsama, %90'dan daha büyük özdeşliğe sahip hizalama uzunluklarının toplamı ile belirlendi. Python 2.7'de NetworkX ile �ğlı bileşenler” (Hagberg ve diğerleri, 2008). Her bağlı bileşen için, referans olarak kullanmak üzere en bağlı plazmidi (hub) çıkardık. Birden fazla hub olduğunda, hub'ları boyuta göre sıraladık ve en büyük plazmidi seçtik. Plazmit soyları ve ilgili referanslar, Ek Tablo S1'de listelenmiştir.

Plazmid Replikasyon Proteinlerinin Ekstraksiyonu

Plazmit başlatma replikasyon proteinlerini çıkarmak için açıklama tabanlı bir yaklaşım kullandık. Plazmit GenBank dosyalarını kullanarak, ürünlerde şu anahtar kelimeler için büyük/küçük harfe duyarsız bir arama gerçekleştirdik: “replication protein”, “plasmid repplication initiator”, “plasmid repplication”, 𠇍NA replikasyonu” , & #x201Creplicase”. Ardından, hem nükleotid hem de protein dizilerini çıkardık ve kısmi genleri ve psödojenleri hariç tuttuk. Ek olarak, daha fazla analiz için Rep geninin yukarısında ve aşağısında 500 nükleotid çıkardık. Tüm bu süreç Python 2.7 ve Biopython SeqIO modülü ile gerçekleştirildi (Cock ve diğerleri, 2009).

Homoloji Grubu Tanımlaması için Referans Proteinler

Bertini ve arkadaşları tarafından bildirilen tüm replikasyon (Rep) proteinlerini derledik. (2010) (Bertini ve diğerleri, 2010) gen adına, plazmit adına ve varsa plazmit erişim numarasına göre. Rep proteinlerinin bir lokus etiketine veya gen adına sahip olmadığı durumlar için replikon kimliği ve replikaz adı kullanılarak oluşturulmuş yapay bir lokus etiketi ekledik. Replika adı mevcut olmadığında, replikaları ayırt etmek için ‘rep’ kelimesini ve ardından GenBank dosyasındaki görünüm sırasına göre bir sayı atadık. Bazı durumlarda, aynı plazmitte iki replikasyon proteini olduğunda, bu proteinleri belirli homoloji grupları için referanslar olarak doğru bir şekilde atamak için, bu proteinlerin GenBank nr veri tabanına karşı BLAST araştırması yaptık ve bunun dışında karşılık gelen isabetleri belirledik. Acinetobacter Bertini ve diğerlerinde Ek Tablo S1'de bildirilen cins. (2010). İki protein tanımlanamadı: Plazmit dizisi veri tabanlarında depolanmadığı için Ab599 plazmidinden (GR3 üyesi) Aci3 kopyası ve plazmid, replika. Bu nedenle, bu proteinleri analizlerimizden çıkardık ve bunun yerine aynı homoloji gruplarının diğer üyelerini inceledik. Lean ve Yeo (2017) tarafından bildirildiği gibi, GR2 homoloji grubu iki gruba ayrılmalıdır, bu nedenle GR2'yi temsil eden proteinleri yeni oluşan GR20'nin proteinlerinden ayırdık. Ek olarak, (Cameranesi ve diğerleri, 2017) yakın zamanda yeni homoloji grupları bildirdi, bu nedenle bu grupları temsil eden replikazları barındıran plazmitleri indirdik ve bu genleri çıkardık. Ek Tablo S2, Ek Malzemeler S1, S2'de bulunan çoklu FASTA dosyalarında kullanılan kökenler, erişimler, sayılar ve başlıklar dahil olmak üzere bu çalışmada referans olarak kullanılan tüm proteinleri listeler.

Rep Proteinleri için Homoloji Grubu Ataması

İlk olarak, plazmit koleksiyonumuzda bulunan replikasyon başlatma proteinlerini kodlayan tüm genler arasında eşleştirilmiş BLASTn (Camacho ve diğerleri, 2009) aramaları yaptık. %74'ten fazla nükleotid özdeşliğine sahip ve sorgunun en az %90'ını kapsayan isabetleri koruduk. Ardından, sorgu kodlama dizisi (CDS) yalnızca bir homoloji grubuna eşleniyorsa, diziyi o gruba ait olarak belirledik, farklı homoloji grupları için birden fazla isabet varsa, sorguyu en yüksek GR'ye atadık. yüzde kimliği. İlişkili referans (KY984047_repAci23), GR8 referanslarından biriyle (GU979000.1_p11921_repA) %100 aynı olduğundan GR23 homoloji grubunu çıkardık.

Plazmid Rep Proteini Filogenetik Analizi ve Yeni Homoloji Gruplarının Belirlenmesi

İki gen en az %74 nükleotid özdeşliği ve %90 kapsama alanı paylaşıyorsa, bir Rep proteinini kodlayan her genin diğerine bağlı olduğu bir ağ kurduk. Ardından, referans tablosunda Rep proteini olmayan adalar veya bağlı bileşenler için göbeği referans olarak seçtik ve Ek Tablo S1'e ekledik. Ek olarak, mevcut atamaları ve yeni homoloji gruplarını doğrulamak için plazmid replikasyon başlatma protein filogenileri oluşturduk. 21 Şubat'ta erişilen Pfam veritabanında (El-Gebali ve diğerleri, 2019) ilişkili Pfam alan adlarını aradık NS , 2018, proteinleri korunan alanlara göre ayırmak ve bu proteinler çok farklı olduğu için hizalamaları ayrı ayrı gerçekleştirmek. Amino asitleri hizalamak için Clustal Omega'yı (Sievers ve diğerleri, 2014) ve çevrilmiş CDS tarafından nükleotit hizalamasını yönlendirmek için RevTrans'ı (Wernersson ve Pedersen, 2003) kullandık. Ardından, yeterli bir evrimsel model aramak için jModelTest2'yi (Darriba ve diğerleri, 2012) çalıştırdık ve seçilen modelle PHYML (Guindon ve Gascuel, 2003) ile filogenetik ağacı oluşturduk. Görsel inceleme ile, yeni homoloji gruplarının referanslarını, yeni kordları temsil edebilecek seçilmiş proteinleri doğruladık ve bu proteinleri Ek Tablo S2'de ayrıntılı olarak açıklandığı gibi yeni homoloji grupları olarak belirledik.

Ribozomal Proteinlerin ve MLST'nin Filogenetik Analizi

Çekirdek genoma ait olan ve hizalamadaki boşlukları önlemek için tüm suşlarda tam olarak aynı boyuta sahip olan ribozomal proteinleri kodlayan monokopi genleri çıkarmak için Roary'yi (Page ve diğerleri, 2015) kullandık. RevTrans ile nükleotit hizalamasını yönlendirmek için ribozomal proteinleri Clustal Omega (Sievers ve diğerleri, 2014) ile hizaladık (Wernersson ve Pedersen, 2003). RDP4 ile tespit edilen rekombinasyon sinyallerine sahip dizileri attık (Martin ve diğerleri, 2015). Kalan nükleotid hizalamalarını FASconCAT-G (K࿌k ve Longo, 2014) ile birleştirdik ve PHYML ile filogenetik bir ağaç oluşturmak için evrimsel modeli seçmek için jModelTest2'yi (Darriba ve diğerleri, 2012) kullandık (Guindon ve Gascuel, 2003). ribozomal proteinlerini kullandık. Acinetobacter hemolyticus Bir dış grup olarak CIP 64.3 suşu. Her birinin dizi tipi (ST) ataması A. baumannii izolat, Oxford ve Pasteur MLST şemaları altında, PubMLST veri tabanı 1'den elde edildi (Bartual ve diğerleri, 2005 Diancourt ve diğerleri, 2010).

Plazmitlerde Salgı Sistemlerinin, Antibiyotik Direnç Genlerinin ve Ekleme Dizilerinin Belirlenmesi

Plazmit koleksiyonundaki sekresyon sistemlerini belirlemek için TXSSCAN profilleriyle (Abby ve Rocha, 2017) MacSyFinder'ı ve plazmit setimizde bulunan edinilmiş antibiyotik direnç genlerini tanımlamak için ResFinder'ı kullandık (Zankari ve diğerleri, 2012). 2'de ISfinder veri tabanını kullanarak plazmitlerde bulunan yerleştirme dizisi (IS) elemanlarını belirledik (Siguier ve diğerleri, 2006).

Tanımlanması pdf Plazmitlerdeki Siteler (XerC/D ve Xer D/C)

tanımlamak için pdf plazmit kümemizdeki siteleri sorgular olarak kullanarak bir BLASTn analizi yaptık. pdf plazmid pS30-1'in yerleri: XerC/D, ATTTCGTATAAGGTGTATTAT- GTTAATT ve XerD/C, ATTTAACATAATGGCTGTTATGCGAAAC (Blackwell ve Hall, 2017).

COG Atamaları

kullanarak gizli Markov modeli (HMM) aramalarına dayalı olarak her plazmit için homolog gen atamaları belirledik. hmmarama programı (Eddy, 2011). Bu HMM arama işlemi, 4873 COG ve 8539 Kalan Ortolog Grup'un (ROG'lar) her birini temsil eden önceden oluşturulmuş bir model seti kullanır (Tatusov ve diğerleri, 2003 Taboada ve diğerleri, 2010). Daha sonra, Perl betiklerini kullanarak, Tatusov'un [66] genel sınıflandırma şemasını kullanarak atanan her COG'yi sınıflandırdık. Her bir genin sınıf başına sıklığını hesapladık ve sonuçları ggplot2 R komut dosyaları 3'ü kullanarak çizdik (Wickham, 2009).


PCURE: Antibiyotik direnci yükünü azaltmak için plazmitleri hedefleme

Antibiyotiğe dirençli enfeksiyonlar, onlarla savaşmak için somut yeni yaklaşımların olmaması nedeniyle yoğunlaşan büyük bir küresel sağlık sorunu olarak kabul edilmiştir. Plazmitler, direnç genlerinin dünya çapında hızla yayılmasına en büyük katkıda bulunanlardan biri olarak kabul edilmektedir. Bununla birlikte, şu anda özellikle plazmitleri hedefleyen birkaç strateji izlenmektedir. Çalışmamız, plazmit kodlu toksin/anti-toksin sistemlerini nötralize ederek hücre canlılığını bozmadan uyumsuzluk işlevlerini kullanarak plazmitleri konaklarından uzaklaştırmanın yollarını geliştiriyor. Bu yaklaşım umut verici laboratuvar ortamında ancak direniş sorunuyla savaşmak için uygun bir seçenek olarak daha fazla gelişmeye ve tanınmaya ihtiyaç duyar.

Çoklu ilaca dirençli (MDR) bakterilerin mevcut yaygın oluşumu, bakteriyel enfeksiyonlara bağlı ölüm oranlarının artmasıyla birlikte ulusal sağlık hizmetleri üzerinde büyük bir yük haline gelmiştir. Soruna büyük ölçüde katkıda bulunan faktörlerden biri, yeni ve mevcut direnç belirleyicilerinin bakteri konakları arasında ne kadar hızlı hareket ettiğidir. Küresel olarak başarılı birçok patojen suşu, mobil genetik elementler (MGE'ler) üzerinde edinilen direnç genlerinin bir sonucu olarak geniş çapta yayılmayı başardı. (1). This rapid spread is in part due to the extensive movement of people, goods and animals for example, all of which allow for the interaction between different bacterial strains and their MGEs, resulting in a globalized gene pool (2).

Plazmitler

Joshua Lederberg first coined the term “plasmid” in 1952 (3), and since their discovery as “extra-chromosomal hereditary determinants”, studies have highlighted their role in horizontal gene transfer (HGT) and usefulness as tools in molecular biology. Much of the early work on plasmids focused on the observation that resistance to antibiotics seemed to transfer from one strain to another, leading to the description of R-factors (4, 5). However, in the early 1970s, Stanley Falkow, Stanley Cohen, Herbert Boyer, Donald Helinski, Charles Brinton and several others developed the concept of using plasmids as tools for gene cloning. The discovery that plasmids could be efficiently used as cloning vectors led to an increased interest in understanding plasmid biology, as well as stimulating new types of biotechnology.

Plasmids are typically circular (but also less commonly linear) double-stranded DNA molecules that are able to independently control their multiplication and stable inheritance from generation to generation in their bacterial h osts (2). In addition, many plasmids can transfer from one bacterium to another, the most sophisticated mechanism being by conjugation in which the plasmid carries genes that can create a bridge between bacteria through which a copy of the plasmid can move (Fig 1a). Some plasmids are not able to do this on their own, but can use the bridge made by other plasmids to transfer themselves. The set of genes for multiplication, stable inheritance and transfer are called the plasmid backbone or core. Plasmids can also pick up a variable cargo of other genes that can help their host bacterium grow or survive in different environments – the plasmid spreads them between bacteria and if a survival advantage is gained due to the carried genes on the plasmid there will be positive selection for its carriage. Amongst the favourable traits carried on plasmids, genes conferring antibiotic resistance are of particular concern in the spread of drug-resistant infections (6).

Although all plasmids basically function in similar ways, what makes targeting plasmids difficult is that the genes and proteins they need for multiplication and stable inheritance are highly diverse making it unlikely to find a single compound that will block them all.

Dominant plasmids

The role of plasmids, particularly those able to transfer autonomously (conjugative), in the spread of antibiotic resistance was quickly established. But it was not until techniques like DNA sequencing became commonplace that the extent of the role plasmids play in the dissemination and evolution of resistance traits became clear (7). Genetically identical plasmids were identified globally in different, completely unrelated strains of bacteria. Genes such as NDM-1 conferring resistance to β -lactam antibiotics, and other essential antibiotics, have been observed on dominant plasmid types that are known to have been in circulation for over 50 years. For example, resistance determinants on one type of plasmid isolated from outbreaks of disease caused by E. koli in Canada were also identified only a few years later on different plasmid backbones in outbreaks of K. pnömoni infection in Sweden . It appears that past antibiotic usage has selected certain plasmids, which are then more likely to pick up the next resistance gene that comes along.

Incompatibility and toxin/anti-toxin systems

All plasmids have ways to control their multiplication so that they do not become a burden to their host bacterium. Closely related plasmids that use the same or similar multiplication genes will therefore compete with each other and cannot be stably inherited together. This is called plasmid “incompatibility” and has been historically used to classify plasmids into different incompatibility groups – plasmids that compete with each other are classified into the same incompatibility group (11). As DNA sequencing technologies developed it became clear that groups of incompatible plasmids shared key parts of their backbones and could be identified by PCR methods . Another class of evolutionary adaptation to ensure stable inheritance inside a host are the toxin/anti-toxin (TA) systems. Many plasmids carry such TA systems, which are usually composed of a stable toxin and an unstable anti-toxin. This means that if the plasmid is lost, the stable toxin outlives the unstable anti-toxin, resulting in death or reduced viability of the plasmid-free cell, and thus maintenance of the plasmid within the overall population (14).

Plasmid curing

As the problem of antibiotic resistance grows, and the number of new antibiotics fails to provide a solution, novel approaches are required to tackle the issue. Since the initial discovery of plasmids, efforts have been made to eliminate, or “cure”, them from their hosts in order to better understand the biological role that these elements have. Early attempts to eliminate plasmids by Salisbury et al. (15) involved stressing the host either by growing the bacterium at higher than optimal temperatures, or by adding chemical compounds such as acridine orange, sodium dodecyl sulfate (SDS) or ethidium bromide. These interventions were only successful for some plasmids and generally also resulted in mutations and damage to the host. Approaches such as these are also not amenable to use in curing plasmids beyond the laboratory.

As more was learned about plasmid replication in the 1970s and with the development of gene cloning, plasmid regions that specifically interfered with stable inheritance were discovered. Different groups, including Hynes et al. (16), developed techniques that relied on identifying the incompatibility groups of the target plasmids and then introducing plasmids with the same incompatibility group to induce curing. This technique was refined by Stolt et al. (17), who cloned only the specific regions that determine incompatibility onto a vector, and showed that this could cure a plasmid carried by Mycobacterium fortuitum. Uraji et al. (18) refined the work of Stolt et al. (1996), by cloning the replication functions to induce incompatibility onto a vector carrying a gene that could be induced to self-destruct. This allowed for the selection of completely plasmid-free strains.

Although the mentioned studies demonstrated the feasibility of using incompatibility to stably cure plasmids from bacterial populations, using this, as an alternative approach to deal with increasingly antibiotic resistance strains was first truly conceptualized in a patent application filed by Filutowicz (19).

Denap et al. (20) took the concept of incompatibility and used it as a rationale to test small chemicals that specifically target functions required for plasmid replication. They used aminoglycosides, which are known to target RNA, and tested their ability to block the replication of plasmids that use RNA as control elements during replication. Their studies showed that when using these drugs a bacterial population could be re-sensitized. However, using antibiotics to try and reduce the problem of antibiotic resistance is not an optimal strategy and many plasmids carry aminoglycoside resistance genes. Nevertheless, it brought forward the concept that plasmids could be a good target for new therapeutic strategies, an idea which was supported by Latha et al. (21) who isolated plant extracts with anti-plasmid properties.

More recently, several groups including ours have looked at ways to specifically target plasmids that carry antibiotic resistance using genetic techniques. Bikard et al. (22) and Ji et al. (23) used CRISPR-Cas to design target-specific systems delivered either by bacteriophages (22) or conjugative plasmids (23). These approaches highlight how genetic techniques can be used instead of chemical compounds as antimicrobials and warrants further development alongside approaches such as phage therapy.

PCURE

The presence of large antibiotic resistance plasmids in bacterial populations is the major determinant of poor clinical outcome during hospital-acquired infections (HAI). Vulnerable or immunocompromised patients commonly suffer from HAIs when bacteria that are normally carried in the gut or on the skin infect wound sites following surgery or form biofilms on indwelling devices such as ventilators and catheters leading to pneumonia or UTIs (Fig. 2). Due to the facility with which plasmids can transfer among bacteria, including gut bacteria, developing a system whose purpose is to displace antibiotic resistance plasmids from particular environments could be a good approach to reduce the burden of antibiotic resistance.

T he pCURE system was developed in the Thomas laboratory by combining functions to block replication of a target plasmid whilst also neutralizing any TA system it carries (Fig. 1b). These “curing functions” are cloned into a different vector that is not itself incompatible with (and therefore blocked by) the target plasmid(s). The combination of targeting multiple replicons and neutralizing TA systems makes our approach unique and essential for applications in environments where one would not want to disrupt the normal ecological balance. For example, it could provide a clear advantage over antibiotic treatment, which can often disrupt the gut microbiota and can result in overgrowth of resistant pathogens such as C. difficile. Hale et al. (24) showed that the pCURE system could be engineered and applied to target different types of plasmids and that it cured at very high efficiency. Although useful in an laboratuvar ortamında setting as shown by several groups who used the system to cure important resistance plasmids (25, 26), the pCURE described by Hale et al. (24) could not be used in more complex environments because it is not self-transmissible.

Currently work in our group is being undertaken to develop a pCURE system that is self-transmissible and could therefore spread among complex microbial communities, displacing antibiotic resistance plasmids as it does so (Fig. 1c). To achieve this goal we are using conjugative IncP-1 plasmids as the core of our vector because of their very broad host range (27) allowing efficient spread through complex communities. We have so far shown that these conjugative pCURE plasmids can transfer, invade and displace an IncF plasmid from a bacterial population in the absence of external selection (Lazdins et al. unpublished results). Work is currently ongoing to expand the curing potential to target a range of natural antibiotic-resistance plasmids and to optimize transfer rates.

Future work and applications for pCURE

In countries where general rates of antibiotic resistance are low (e.g., The Netherlands) it is common practice that all patients entering intensive care units (ITUs) undergo selective digestive and/or oropharyngeal decontamination (SDD and SOD) (28). These involve the administration of prophylactic antibiotics in order to try and reduce the prevalence of infections that would lead to increased mortality. Although effective in decreasing the mortality rates (29), the disruption caused to the normal flora and the possible development of further antibiotic-resistant strains is not ideal. Our vision for pCURE is that it could be used as a prophylactic measure in a similar way to SDD or SOD, given to patients who enter healthcare settings. By giving pCURE to patients at risk of developing infections upon admission to hospital, the idea is that if an infection develops, then it is more likely for it to be sensitive to standard antibiotic therapy, due to displacement of the plasmids carrying resistance (Fig. 2). This can also be applied to healthcare workers to limit possible spread of any antibiotic-resistant strains that they may be carrying.

Another area where we think that pCURE would be particularly useful is in limiting the international spread of resistance. There are places where the number of strains carrying plasmids with multiple antibiotic resistance genes is higher than others (Southeast Asia vs. Scandinavia for example) and studies have demonstrated that individuals travelling to places with higher occurrence will quickly be colonized by resistance strains even without becoming ill and these strains can remain in their flora for extended periods (30). Therefore, upon returning from places with a high risk of colonization, travellers could take a course of pCURE to eradicate any problematic resistance genes they have acquired. For this vision to be realised several steps need to be taken to ensure that pCURE becomes a cost-efficient, adaptable and, most importantly, safe system to use in human medicine.

Bacterial conjugation in the gastrointestinal tract (GIT) of humans is poorly understood, and although there is evidence that conjugation is an important factor influencing HGT in the GIT (See (31)) for a current review), more work will be needed to fully understand the extent of pCURE spread once administered. These studies will require the use of animal models or complex in vitro gut models. Once these studies are done, more work can be undertaken to optimize pCURE as a transfer agent, but also to find the best way to administer it. We are currently taking inspiration from probiotics and faecal transplant treatments, where in both cases live bacteria are successfully delivered to the gastrointestinal tract.

Safety considerations are essential when establishing how best to administer pCURE and track how it spreads. Plasmids have the ability to pick up resistance genes extremely easily as well as having the ability to integrate into bacterial-host chromosomes. To ensure safety and avoid fears of releasing genetically modified elements into nature, we would need to prevent the acquisition of resistance genes by the pCURE vector as well as the potential for chromosomal integration by including genetic safeguards in our system. These would include systems that specifically block the ability of plasmids to acquire extra resistance genes as well introducing specific self-destruct mechanisms to avoid pCURE from working outside of the body.

Extensive discussions will also be needed with safety governing bodies (for example, the FDA or EMA) regarding the classification and requirements for the usage of pCURE. At present, pCURE sits somewhere between a food, a drug and a biologic so specific requirements for trials and approval in human usage will need to be clarified. Alongside this clarification, studies on how the public would perceive pCURE as a product are essential. A lot is known about the reticence that people have for using genetically modified organisms (GMOs) (32, 33), but would this reticence change in the face of the dangers of antibiotic resistance?

Çözüm

Even though plasmids are the major reason for the development and spread of resistance among naïve bacterial populations, very little attention is being given to these elements as targets for combating the maintenance and spread of antibiotic resistance. The knowledge and technology to develop plasmid-curing technologies is accessible, and many groups have used a range of approaches to achieve this goal in vitro. However, the jump to using these kinds of systems in more complex environments has yet to be realized. We believe that the practical value of pCURE should be explored as an efficient way to cure antibiotic-resistance plasmids from strains colonizing the GIT in a way that would not disrupt the normal flora, resulting in a reduced clinical burden if infection were to manifest itself.

Biyografiler

Dr Claire Miller gained her PhD in Bacterial Genetics from the University of Leicester, followed by a three year post-doctoral research position in the same laboratory. She is currently working in the laboratory of ProfessorThomas at the University of Birmingham. She joined the laboratory on a Wellcome Trust ISSF Translational Award to develop plasmid curing as a method for reducing antibiotic resistance carriage in bacteria.

Dr Mark A Webber is interested in the study of the mechanisms and biology of antibiotic resistance, bacterial responses to stress and biofilm formation and has published over 50 articles in these areas since 2001. He was awarded a BBSRC David Phillips Fellowship in 2007 and took up a tenured position within the Institute for Microbiology and Infection at Birmingham at the beginning of 2012.

 Professor Christopher M Thomas is Professor of Molecular Genetics in the School of Biosciences and Institute of Microbiology and Infection at the University of Birmingham. He has been passionate about bacterial plasmids as systems ever since his DPhil in Oxford with Keith Dyke and postdoc with Donald Helinski at University of California, San Diego. He led the creation of the International Society for Plasmid Biology in 2004 and set up Plasgene in 2006 based on plasmid curing technology.


How Much Do You Know About the Prokaryotic Expression System?

E. coli protein expression system is the most commonly used expression system for recombinant proteins. Prokaryotic expression vectors generally consist of the replicon, promoters, selection markers, multiple cloning sites (MCS) and fusion tags / restriction sites.


The replicon is comprised of the origin of replication (ORI) and all of its control elements. The ORI is the place where DNA replication begins, enabling a plasmid to reproduce itself as it must to survive within cells. The best choice of ORI depends on how many plasmid copies you want to maintain, which host or hosts you intend to use, and whether or not you need to consider your plasmid's compatibility with one or more other plasmids. Commonly used pET (Novagen) series vectors mainly carry pMB1 ori, providing a copy number of 15-60 pQE vectors (Qiagen) carrying ColE1 ori provides a copy number of 15-20 pACYC and pBAD series of vectors carry p15A ori, giving a copy number of 10-12, and are commonly used for the co-expression of two recombinant proteins. (Misunderstanding: Does high copy number of the carrier result in high protein expression yield? High copy of the exogenous plasmids will create a greater burden on the normal metabolism of the host, which may slow down cell proliferation, destabilize the plasmid, and eventually compromise the final expression yield of the recombinant protein.) This following table defines common cloning vectors, their copy number, ORI, and incompatibility groups.

Table 1. Common Prokaryotic Expression Vectors and ORIs


Cullum, J., Collins, J. F., Broda, P.: Factors affecting the kinetics of progeny formation with F'lac in Escherichia koli K12. plazmit 1, 536–544 (1978a)

Cullum, J., Collins, J. F., Broda, P.: The spread of plasmids in model populations of Escherichia koli K12. plazmit 1, 545–556 (1978b)

Cullum, J., Broda, P.: Rate of segregation due to plasmid incompatibility. Genet. Araş. 33, 61–79 (1979)

Finger, J., Krishnapillai, V.: Host range, entry exclusion, and incompatibility of Pseudomonas aeruginosa FP plasmids. plazmit 3, 332–342 (1980)

Ishii, K., Kashimoto-Gotoh, T., Matsubara, K.: Random replication and random assortment model for plasmid incompatibility in bacteria. plazmit 1, 435–445 (1978)

Nordström, K., Molin, S., Aagaard-Hansen, H.: Partitioning of plasmid R1 in Escherichia koli. I. Kinetics of loss of plasmid derivatives deleted of the par region. plazmit 4, 215–227 (1980)

Nordström, K., Aagaard-Hansen, H.: Maintenance of bacterial plasmids: comparison of theoretical calculations and experiments with plasmid R1 in Escherichia koli. Mol. Gen. 197, 1–7 (1984)

Novick, R. P., Hoppensteadt, F. C.: On plasmid incompatibility. plazmit 1, 421–434 (1978)

Simmons, G. F.: Introduction to topology and modern analysis. McGraw-Hill, New York 1963

Stewart, F. M., Levin, B. R.: The population biology of bacterial plasmids: a priori conditions for the existence of conjugationally transmitted factors. Genetik 87, 209–228 (1977)

Van der Hoeven, N. A mathematical model for the co-existence of incompatible, conjugative plasmids in individual bacteria of a bacterial population. J. Teori. Biol. 110, 411–423 (1984)

Van der Hoeven, N.: Evolution of bacterial surface exclusion against incompatible plasmids. J. Teori. Biol. 117, 431–452 (1985)

Willetts, N., Maule, J.: Interaction between the surface exclusion systems of some F-like plasmids. Genet. Araş. 24, 81–89 (1974)